FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634107_at:

>probe:Drosophila_2:1634107_at:655:651; Interrogation_Position=224; Antisense; TCAAGCCAATTGCACTGTCCTGCGA
>probe:Drosophila_2:1634107_at:142:399; Interrogation_Position=247; Antisense; GACACCGTGGAGTCGCACAAGGGTT
>probe:Drosophila_2:1634107_at:215:729; Interrogation_Position=293; Antisense; TTGGCAAGCTGAGCTCCTTTGACTA
>probe:Drosophila_2:1634107_at:538:725; Interrogation_Position=311; Antisense; TTGACTATCCCATCATTGCGGACGA
>probe:Drosophila_2:1634107_at:364:321; Interrogation_Position=413; Antisense; GCGCCGTTTTCGTGGTGGACGACAA
>probe:Drosophila_2:1634107_at:729:209; Interrogation_Position=436; Antisense; AAGAAGAAGCTTCGCCTGTCCATCC
>probe:Drosophila_2:1634107_at:420:261; Interrogation_Position=471; Antisense; CACCACTGGGCGCAACTTTGATGAA
>probe:Drosophila_2:1634107_at:156:433; Interrogation_Position=503; Antisense; GAGTGATCGACTCGCTCCAGTTGAC
>probe:Drosophila_2:1634107_at:720:721; Interrogation_Position=586; Antisense; TTGCCCACCGTCAAAGCCGAAGATG
>probe:Drosophila_2:1634107_at:399:215; Interrogation_Position=605; Antisense; AAGATGTTCCTAAGCTCTTTCCTGA
>probe:Drosophila_2:1634107_at:633:539; Interrogation_Position=631; Antisense; GGTATCGAAACCATTGAGCTGCCCT
>probe:Drosophila_2:1634107_at:356:719; Interrogation_Position=644; Antisense; TTGAGCTGCCCTCCGGAAAGAGTTA
>probe:Drosophila_2:1634107_at:713:171; Interrogation_Position=660; Antisense; AAAGAGTTACCTGCGGATCACTCCA
>probe:Drosophila_2:1634107_at:149:279; Interrogation_Position=690; Antisense; CTAATGGATGACAAGCGTGCGCTCT

Paste this into a BLAST search page for me
TCAAGCCAATTGCACTGTCCTGCGAGACACCGTGGAGTCGCACAAGGGTTTTGGCAAGCTGAGCTCCTTTGACTATTGACTATCCCATCATTGCGGACGAGCGCCGTTTTCGTGGTGGACGACAAAAGAAGAAGCTTCGCCTGTCCATCCCACCACTGGGCGCAACTTTGATGAAGAGTGATCGACTCGCTCCAGTTGACTTGCCCACCGTCAAAGCCGAAGATGAAGATGTTCCTAAGCTCTTTCCTGAGGTATCGAAACCATTGAGCTGCCCTTTGAGCTGCCCTCCGGAAAGAGTTAAAAGAGTTACCTGCGGATCACTCCACTAATGGATGACAAGCGTGCGCTCT

Full Affymetrix probeset data:

Annotations for 1634107_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720