FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634108_at:

>probe:Drosophila_2:1634108_at:250:143; Interrogation_Position=483; Antisense; ACTGGTCAGGAAGGTCACGTTCATC
>probe:Drosophila_2:1634108_at:22:131; Interrogation_Position=526; Antisense; ACCTGTTGGTTGTTCTGGTCGGATT
>probe:Drosophila_2:1634108_at:597:485; Interrogation_Position=542; Antisense; GGTCGGATTCCCATTAATCTCGGTA
>probe:Drosophila_2:1634108_at:535:23; Interrogation_Position=573; Antisense; ATACTTGGACGCTTAATTCCCTGGG
>probe:Drosophila_2:1634108_at:186:245; Interrogation_Position=587; Antisense; AATTCCCTGGGAAGATGCCCTGTTG
>probe:Drosophila_2:1634108_at:642:625; Interrogation_Position=602; Antisense; TGCCCTGTTGCGCTTCATTAGAATA
>probe:Drosophila_2:1634108_at:384:271; Interrogation_Position=648; Antisense; CTTTCAATGATGTGCCTAGGACGGA
>probe:Drosophila_2:1634108_at:423:395; Interrogation_Position=671; Antisense; GAAATATGACCACCAGACCGAACCA
>probe:Drosophila_2:1634108_at:704:275; Interrogation_Position=700; Antisense; CTTCTGCGCCAATGACCGAATATTC
>probe:Drosophila_2:1634108_at:389:365; Interrogation_Position=717; Antisense; GAATATTCAGCATCGCGGGTGGTCT
>probe:Drosophila_2:1634108_at:285:429; Interrogation_Position=784; Antisense; GAGTTCTTTACAGCTCTGTCGACGA
>probe:Drosophila_2:1634108_at:17:531; Interrogation_Position=857; Antisense; GGGATTCCTCAAAATGTACCTCATG
>probe:Drosophila_2:1634108_at:505:149; Interrogation_Position=892; Antisense; ACATCTGTCGTATGAAGCGTCGTGT
>probe:Drosophila_2:1634108_at:192:127; Interrogation_Position=937; Antisense; ACCTAGCGGAGGCAGACGGACACTA

Paste this into a BLAST search page for me
ACTGGTCAGGAAGGTCACGTTCATCACCTGTTGGTTGTTCTGGTCGGATTGGTCGGATTCCCATTAATCTCGGTAATACTTGGACGCTTAATTCCCTGGGAATTCCCTGGGAAGATGCCCTGTTGTGCCCTGTTGCGCTTCATTAGAATACTTTCAATGATGTGCCTAGGACGGAGAAATATGACCACCAGACCGAACCACTTCTGCGCCAATGACCGAATATTCGAATATTCAGCATCGCGGGTGGTCTGAGTTCTTTACAGCTCTGTCGACGAGGGATTCCTCAAAATGTACCTCATGACATCTGTCGTATGAAGCGTCGTGTACCTAGCGGAGGCAGACGGACACTA

Full Affymetrix probeset data:

Annotations for 1634108_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720