FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634113_at:

>probe:Drosophila_2:1634113_at:367:673; Interrogation_Position=1016; Antisense; TAGCCACTGGATCCGAACCTTAAGT
>probe:Drosophila_2:1634113_at:611:701; Interrogation_Position=1068; Antisense; TTTTGTACCATATGTCTTCTCACCG
>probe:Drosophila_2:1634113_at:498:275; Interrogation_Position=1083; Antisense; CTTCTCACCGTTCGATAAGCTTATC
>probe:Drosophila_2:1634113_at:402:383; Interrogation_Position=1163; Antisense; GAACTGTAACCTCTTGTATCTGTAT
>probe:Drosophila_2:1634113_at:656:447; Interrogation_Position=1246; Antisense; GATCCGATTTAGCATTACGCCTAGT
>probe:Drosophila_2:1634113_at:621:305; Interrogation_Position=1265; Antisense; CCTAGTCGTTAGTTGGATGCTCCTG
>probe:Drosophila_2:1634113_at:556:249; Interrogation_Position=736; Antisense; CAAGGAATCATGTCTCCCCAAGATG
>probe:Drosophila_2:1634113_at:284:69; Interrogation_Position=780; Antisense; AGGCGGATTACCAACTCAGCGAAAA
>probe:Drosophila_2:1634113_at:465:589; Interrogation_Position=848; Antisense; TGGATGATGAACATGCCGCCGAGCA
>probe:Drosophila_2:1634113_at:23:169; Interrogation_Position=872; Antisense; AAATGGTATTTTGCGGCCCACATGG
>probe:Drosophila_2:1634113_at:103:65; Interrogation_Position=893; Antisense; ATGGGCGAACTCATGCGTCACACTG
>probe:Drosophila_2:1634113_at:68:583; Interrogation_Position=916; Antisense; TGGCGACAATCTCAGCGGACCTATG
>probe:Drosophila_2:1634113_at:552:553; Interrogation_Position=932; Antisense; GGACCTATGGGATGCGCCAATCTCT
>probe:Drosophila_2:1634113_at:547:161; Interrogation_Position=961; Antisense; AAATTGCCCGATCAGCTCCAAGAAG

Paste this into a BLAST search page for me
TAGCCACTGGATCCGAACCTTAAGTTTTTGTACCATATGTCTTCTCACCGCTTCTCACCGTTCGATAAGCTTATCGAACTGTAACCTCTTGTATCTGTATGATCCGATTTAGCATTACGCCTAGTCCTAGTCGTTAGTTGGATGCTCCTGCAAGGAATCATGTCTCCCCAAGATGAGGCGGATTACCAACTCAGCGAAAATGGATGATGAACATGCCGCCGAGCAAAATGGTATTTTGCGGCCCACATGGATGGGCGAACTCATGCGTCACACTGTGGCGACAATCTCAGCGGACCTATGGGACCTATGGGATGCGCCAATCTCTAAATTGCCCGATCAGCTCCAAGAAG

Full Affymetrix probeset data:

Annotations for 1634113_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720