FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634114_at:

>probe:Drosophila_2:1634114_at:21:191; Interrogation_Position=242; Antisense; AACTATCAAGTACCGGCCATCCAAT
>probe:Drosophila_2:1634114_at:56:129; Interrogation_Position=295; Antisense; ACCACACTCCAATTGGGCTGCAGGT
>probe:Drosophila_2:1634114_at:532:523; Interrogation_Position=324; Antisense; GGGCGCGTTTTGGATCAGATCGTCT
>probe:Drosophila_2:1634114_at:688:261; Interrogation_Position=339; Antisense; CAGATCGTCTTGGTTCGGTTTTGGT
>probe:Drosophila_2:1634114_at:305:159; Interrogation_Position=391; Antisense; ACAAACGAGCTGACAATGCCCCATG
>probe:Drosophila_2:1634114_at:428:323; Interrogation_Position=421; Antisense; GCGACGGTACGTGCGGCCAAACAAA
>probe:Drosophila_2:1634114_at:580:559; Interrogation_Position=452; Antisense; GGAAATTGCGTCACCTGCAGGAATT
>probe:Drosophila_2:1634114_at:27:73; Interrogation_Position=470; Antisense; AGGAATTTCCACTCGACATTGTCAA
>probe:Drosophila_2:1634114_at:641:653; Interrogation_Position=529; Antisense; TAATTTGACATTTTACGGCCCAGGA
>probe:Drosophila_2:1634114_at:50:425; Interrogation_Position=574; Antisense; GAGACCGCAGAGCAACGCAGGACAA
>probe:Drosophila_2:1634114_at:669:135; Interrogation_Position=598; Antisense; ACGTTAAATCCACCAGCAGACAGCT
>probe:Drosophila_2:1634114_at:458:439; Interrogation_Position=638; Antisense; GATGCTGGAGCCACCAAGGGATCTT
>probe:Drosophila_2:1634114_at:597:351; Interrogation_Position=666; Antisense; GCAGCATCTCGGTCACTCGGAAAAG
>probe:Drosophila_2:1634114_at:317:285; Interrogation_Position=749; Antisense; CTGAAGGATTCGCTTTCATGGCTAT

Paste this into a BLAST search page for me
AACTATCAAGTACCGGCCATCCAATACCACACTCCAATTGGGCTGCAGGTGGGCGCGTTTTGGATCAGATCGTCTCAGATCGTCTTGGTTCGGTTTTGGTACAAACGAGCTGACAATGCCCCATGGCGACGGTACGTGCGGCCAAACAAAGGAAATTGCGTCACCTGCAGGAATTAGGAATTTCCACTCGACATTGTCAATAATTTGACATTTTACGGCCCAGGAGAGACCGCAGAGCAACGCAGGACAAACGTTAAATCCACCAGCAGACAGCTGATGCTGGAGCCACCAAGGGATCTTGCAGCATCTCGGTCACTCGGAAAAGCTGAAGGATTCGCTTTCATGGCTAT

Full Affymetrix probeset data:

Annotations for 1634114_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720