Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634116_at:

>probe:Drosophila_2:1634116_at:97:331; Interrogation_Position=4566; Antisense; GCGGAGCTGGCCTTATTGGACGATC
>probe:Drosophila_2:1634116_at:688:689; Interrogation_Position=4579; Antisense; TATTGGACGATCTGACCGGTGGCCC
>probe:Drosophila_2:1634116_at:49:321; Interrogation_Position=4600; Antisense; GCCCCAATTTCCAAGCCGAGATGAA
>probe:Drosophila_2:1634116_at:603:563; Interrogation_Position=4626; Antisense; GGAATGGCGGGCTACTGCTACACTA
>probe:Drosophila_2:1634116_at:268:339; Interrogation_Position=4642; Antisense; GCTACACTACACTGAAGGCCGCATA
>probe:Drosophila_2:1634116_at:547:69; Interrogation_Position=4657; Antisense; AGGCCGCATATGAGCACGTGACGTC
>probe:Drosophila_2:1634116_at:515:425; Interrogation_Position=4682; Antisense; GAGAGCTCTGCAAAAAATCCCCTGA
>probe:Drosophila_2:1634116_at:423:115; Interrogation_Position=4715; Antisense; AGCTCAAAGATTTCGGGCTCCGTTG
>probe:Drosophila_2:1634116_at:466:157; Interrogation_Position=4816; Antisense; ACACAAGTGTTGATTTCCCGTAAAT
>probe:Drosophila_2:1634116_at:212:383; Interrogation_Position=4857; Antisense; GAACGACGAAATTCCCTCATATGAT
>probe:Drosophila_2:1634116_at:132:141; Interrogation_Position=4883; Antisense; ACGGGTATTGATTCTGTACAGCCGC
>probe:Drosophila_2:1634116_at:101:601; Interrogation_Position=4897; Antisense; TGTACAGCCGCAATTGATTAGCCCC
>probe:Drosophila_2:1634116_at:483:459; Interrogation_Position=4912; Antisense; GATTAGCCCCTAGTACAGCGTAGAA
>probe:Drosophila_2:1634116_at:571:725; Interrogation_Position=4980; Antisense; TTGTATATTCTAGGCCAACGCGTTA

Paste this into a BLAST search page for me
GCGGAGCTGGCCTTATTGGACGATCTATTGGACGATCTGACCGGTGGCCCGCCCCAATTTCCAAGCCGAGATGAAGGAATGGCGGGCTACTGCTACACTAGCTACACTACACTGAAGGCCGCATAAGGCCGCATATGAGCACGTGACGTCGAGAGCTCTGCAAAAAATCCCCTGAAGCTCAAAGATTTCGGGCTCCGTTGACACAAGTGTTGATTTCCCGTAAATGAACGACGAAATTCCCTCATATGATACGGGTATTGATTCTGTACAGCCGCTGTACAGCCGCAATTGATTAGCCCCGATTAGCCCCTAGTACAGCGTAGAATTGTATATTCTAGGCCAACGCGTTA

Full Affymetrix probeset data:

Annotations for 1634116_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime