Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634117_at:

>probe:Drosophila_2:1634117_at:630:417; Interrogation_Position=2220; Antisense; GAGCTGCTCTGTTCGGAGTCAGTGA
>probe:Drosophila_2:1634117_at:281:73; Interrogation_Position=2245; Antisense; AGGAATACGAGGACATCCGCCTGAT
>probe:Drosophila_2:1634117_at:282:107; Interrogation_Position=2275; Antisense; AGAACTTGTACTTCGTTCAGCACAA
>probe:Drosophila_2:1634117_at:579:419; Interrogation_Position=2307; Antisense; GAGCACTGCATGTCTGATATGTCCA
>probe:Drosophila_2:1634117_at:573:427; Interrogation_Position=2373; Antisense; GAGTTCCTAATCCAGAAGGCCCAAT
>probe:Drosophila_2:1634117_at:225:459; Interrogation_Position=2417; Antisense; GATATTATCCCCTTACAATGGCCAA
>probe:Drosophila_2:1634117_at:453:433; Interrogation_Position=2445; Antisense; GAGTGTATCAAGAACGCGCTTCCCC
>probe:Drosophila_2:1634117_at:244:685; Interrogation_Position=2475; Antisense; TATCGCTCGACTGTGCAAGTGGCCA
>probe:Drosophila_2:1634117_at:515:453; Interrogation_Position=2505; Antisense; GATAGTTTCCAAGGCCTTGAGGCCA
>probe:Drosophila_2:1634117_at:666:69; Interrogation_Position=2524; Antisense; AGGCCAATATAGTGCTGCTCTCGCT
>probe:Drosophila_2:1634117_at:452:507; Interrogation_Position=2550; Antisense; GTGCGCAGCAATATATCCGGCCGAA
>probe:Drosophila_2:1634117_at:68:257; Interrogation_Position=2593; Antisense; CAAATCGAGTGTGCGTGGCTCTTTC
>probe:Drosophila_2:1634117_at:359:593; Interrogation_Position=2628; Antisense; TGGGCCCTGTACATCGTCGGTAATG
>probe:Drosophila_2:1634117_at:607:435; Interrogation_Position=2730; Antisense; GAGGCATTTCCGACCATAACCAGTA

Paste this into a BLAST search page for me
GAGCTGCTCTGTTCGGAGTCAGTGAAGGAATACGAGGACATCCGCCTGATAGAACTTGTACTTCGTTCAGCACAAGAGCACTGCATGTCTGATATGTCCAGAGTTCCTAATCCAGAAGGCCCAATGATATTATCCCCTTACAATGGCCAAGAGTGTATCAAGAACGCGCTTCCCCTATCGCTCGACTGTGCAAGTGGCCAGATAGTTTCCAAGGCCTTGAGGCCAAGGCCAATATAGTGCTGCTCTCGCTGTGCGCAGCAATATATCCGGCCGAACAAATCGAGTGTGCGTGGCTCTTTCTGGGCCCTGTACATCGTCGGTAATGGAGGCATTTCCGACCATAACCAGTA

Full Affymetrix probeset data:

Annotations for 1634117_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime