FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634118_at:

>probe:Drosophila_2:1634118_at:492:5; Interrogation_Position=178; Antisense; ATTCAGCCCGTTCGTAAAATAGTCT
>probe:Drosophila_2:1634118_at:167:491; Interrogation_Position=208; Antisense; GTAAACGATTCAACGCCGGAGCACC
>probe:Drosophila_2:1634118_at:701:321; Interrogation_Position=294; Antisense; GCGAAGTATCCGAAACTTGGCCCGT
>probe:Drosophila_2:1634118_at:615:413; Interrogation_Position=321; Antisense; GACCTATAATACCATCTCGGCGATG
>probe:Drosophila_2:1634118_at:520:587; Interrogation_Position=348; Antisense; TGGAGAAAGATCCTGCTCCTTTGCC
>probe:Drosophila_2:1634118_at:220:167; Interrogation_Position=383; Antisense; AAATGGTTCACACGGCCATCGGAGT
>probe:Drosophila_2:1634118_at:551:25; Interrogation_Position=415; Antisense; ATAGTGGCCCTGTTTATGGTAGTTT
>probe:Drosophila_2:1634118_at:160:597; Interrogation_Position=470; Antisense; TGTTAAACCAAACCCGTGATCCGAT
>probe:Drosophila_2:1634118_at:168:607; Interrogation_Position=486; Antisense; TGATCCGATCGCTGACCTTGTGAGG
>probe:Drosophila_2:1634118_at:277:499; Interrogation_Position=544; Antisense; GTCGAGGGCGAAACTCCTCTAGTAG
>probe:Drosophila_2:1634118_at:655:321; Interrogation_Position=587; Antisense; GCGCCTGCTCCGTGGTACAAAGTAT
>probe:Drosophila_2:1634118_at:614:71; Interrogation_Position=620; Antisense; AGGCATGTGCCTTTGTAGGACCATT
>probe:Drosophila_2:1634118_at:130:555; Interrogation_Position=637; Antisense; GGACCATTGCTTCCTAAGTTTGGCA
>probe:Drosophila_2:1634118_at:247:511; Interrogation_Position=662; Antisense; GTGAACATAATTCCGAGGGCTCCTC

Paste this into a BLAST search page for me
ATTCAGCCCGTTCGTAAAATAGTCTGTAAACGATTCAACGCCGGAGCACCGCGAAGTATCCGAAACTTGGCCCGTGACCTATAATACCATCTCGGCGATGTGGAGAAAGATCCTGCTCCTTTGCCAAATGGTTCACACGGCCATCGGAGTATAGTGGCCCTGTTTATGGTAGTTTTGTTAAACCAAACCCGTGATCCGATTGATCCGATCGCTGACCTTGTGAGGGTCGAGGGCGAAACTCCTCTAGTAGGCGCCTGCTCCGTGGTACAAAGTATAGGCATGTGCCTTTGTAGGACCATTGGACCATTGCTTCCTAAGTTTGGCAGTGAACATAATTCCGAGGGCTCCTC

Full Affymetrix probeset data:

Annotations for 1634118_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720