FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634119_at:

>probe:Drosophila_2:1634119_at:281:705; Interrogation_Position=1025; Antisense; TTAGTGGTGATCTCTCCAATCAGCT
>probe:Drosophila_2:1634119_at:578:119; Interrogation_Position=1046; Antisense; AGCTGCTGAAAACACAGGTGCCATT
>probe:Drosophila_2:1634119_at:678:485; Interrogation_Position=1088; Antisense; GTAGAGATGCCTACGGCAGCTTCGT
>probe:Drosophila_2:1634119_at:582:93; Interrogation_Position=1105; Antisense; AGCTTCGTCAACATCCACGGTGGTC
>probe:Drosophila_2:1634119_at:331:463; Interrogation_Position=1224; Antisense; GATTCTGGTGGGAGTCACCTCCTTC
>probe:Drosophila_2:1634119_at:288:569; Interrogation_Position=1265; Antisense; TGGAAGGCTTTCCAGACGTCTACAC
>probe:Drosophila_2:1634119_at:451:131; Interrogation_Position=1288; Antisense; ACCCGCACCTCGTACTATATGAAGT
>probe:Drosophila_2:1634119_at:259:543; Interrogation_Position=1313; Antisense; GGATTGAGGACACGATCGCCACCCA
>probe:Drosophila_2:1634119_at:164:87; Interrogation_Position=760; Antisense; AGTCGTCGGCGCTATCGAAATGTCA
>probe:Drosophila_2:1634119_at:397:375; Interrogation_Position=816; Antisense; GAAGATCCTCAGCAGGATGCGTCAA
>probe:Drosophila_2:1634119_at:559:353; Interrogation_Position=863; Antisense; GCAGCCACAAGCGTTCGCGAAGACG
>probe:Drosophila_2:1634119_at:124:117; Interrogation_Position=896; Antisense; AGCTAATGAAGCTGGGTCCTCGCCG
>probe:Drosophila_2:1634119_at:210:535; Interrogation_Position=910; Antisense; GGTCCTCGCCGGGATTCGGATGATT
>probe:Drosophila_2:1634119_at:443:95; Interrogation_Position=977; Antisense; AGATTGCCTTTGTGGACTGCGTTGC

Paste this into a BLAST search page for me
TTAGTGGTGATCTCTCCAATCAGCTAGCTGCTGAAAACACAGGTGCCATTGTAGAGATGCCTACGGCAGCTTCGTAGCTTCGTCAACATCCACGGTGGTCGATTCTGGTGGGAGTCACCTCCTTCTGGAAGGCTTTCCAGACGTCTACACACCCGCACCTCGTACTATATGAAGTGGATTGAGGACACGATCGCCACCCAAGTCGTCGGCGCTATCGAAATGTCAGAAGATCCTCAGCAGGATGCGTCAAGCAGCCACAAGCGTTCGCGAAGACGAGCTAATGAAGCTGGGTCCTCGCCGGGTCCTCGCCGGGATTCGGATGATTAGATTGCCTTTGTGGACTGCGTTGC

Full Affymetrix probeset data:

Annotations for 1634119_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720