FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634120_at:

>probe:Drosophila_2:1634120_at:124:537; Interrogation_Position=1880; Antisense; GGTCCCATGCAGGTGATCCACAATG
>probe:Drosophila_2:1634120_at:253:319; Interrogation_Position=1954; Antisense; GCCCATGCCGGACTTGACCAAAAGT
>probe:Drosophila_2:1634120_at:547:79; Interrogation_Position=1976; Antisense; AGTGTACAGCCCAATTTCCGAAGTG
>probe:Drosophila_2:1634120_at:678:593; Interrogation_Position=2004; Antisense; TGGGCAAGGCTTTGACTACCCTCAA
>probe:Drosophila_2:1634120_at:335:105; Interrogation_Position=2035; Antisense; AGACTTGGCTCCCAATTCCAGGGAA
>probe:Drosophila_2:1634120_at:133:1; Interrogation_Position=2062; Antisense; AGGTTCCAGCCTGAAAGGTCCTCCT
>probe:Drosophila_2:1634120_at:167:167; Interrogation_Position=2171; Antisense; AAATCCCAGCCTCCAGTGAGAAGTA
>probe:Drosophila_2:1634120_at:640:183; Interrogation_Position=2213; Antisense; AAAAGAGCTGGTTCCGCGGTGGCAA
>probe:Drosophila_2:1634120_at:145:195; Interrogation_Position=2236; Antisense; AACTCCTCCAACTGGTAACGATAGG
>probe:Drosophila_2:1634120_at:341:287; Interrogation_Position=2299; Antisense; CGGATCCCTACAGCCAGATTCAAAG
>probe:Drosophila_2:1634120_at:109:365; Interrogation_Position=2343; Antisense; GAATCATCGCATCCACTTTAACAAA
>probe:Drosophila_2:1634120_at:172:707; Interrogation_Position=2370; Antisense; TTACGTTTCTCGGTCTTATTGTATT
>probe:Drosophila_2:1634120_at:657:481; Interrogation_Position=2390; Antisense; GTATTAATGTTTTCCGTTGGCAAAG
>probe:Drosophila_2:1634120_at:636:77; Interrogation_Position=2430; Antisense; AGGATGCTCGGCCATCATCGAATGG

Paste this into a BLAST search page for me
GGTCCCATGCAGGTGATCCACAATGGCCCATGCCGGACTTGACCAAAAGTAGTGTACAGCCCAATTTCCGAAGTGTGGGCAAGGCTTTGACTACCCTCAAAGACTTGGCTCCCAATTCCAGGGAAAGGTTCCAGCCTGAAAGGTCCTCCTAAATCCCAGCCTCCAGTGAGAAGTAAAAAGAGCTGGTTCCGCGGTGGCAAAACTCCTCCAACTGGTAACGATAGGCGGATCCCTACAGCCAGATTCAAAGGAATCATCGCATCCACTTTAACAAATTACGTTTCTCGGTCTTATTGTATTGTATTAATGTTTTCCGTTGGCAAAGAGGATGCTCGGCCATCATCGAATGG

Full Affymetrix probeset data:

Annotations for 1634120_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720