Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634121_at:

>probe:Drosophila_2:1634121_at:292:655; Interrogation_Position=140; Antisense; TAATATGTATCTTGACTGTCAGCGT
>probe:Drosophila_2:1634121_at:200:495; Interrogation_Position=157; Antisense; GTCAGCGTGGTCTCCATACAGAGTC
>probe:Drosophila_2:1634121_at:205:155; Interrogation_Position=174; Antisense; ACAGAGTCTCTCACTTCTGGAGGAA
>probe:Drosophila_2:1634121_at:28:15; Interrogation_Position=203; Antisense; ATTACGTGTCAGATTGCCTGGCCAG
>probe:Drosophila_2:1634121_at:11:107; Interrogation_Position=21; Antisense; AGAACCGCCTTTCTGCGAGTAACAG
>probe:Drosophila_2:1634121_at:622:363; Interrogation_Position=247; Antisense; GAATTCCAGGAACTCATCGATCGCA
>probe:Drosophila_2:1634121_at:290:43; Interrogation_Position=262; Antisense; ATCGATCGCAACAGCTCCGAAGAGG
>probe:Drosophila_2:1634121_at:706:435; Interrogation_Position=283; Antisense; GAGGATGACCTCGAGAATACCGACA
>probe:Drosophila_2:1634121_at:284:167; Interrogation_Position=316; Antisense; AAATGCTTCATCCATTGCCTAGCGG
>probe:Drosophila_2:1634121_at:338:7; Interrogation_Position=397; Antisense; ATTGAGCCCGTGAGCGATGAACTGC
>probe:Drosophila_2:1634121_at:718:699; Interrogation_Position=46; Antisense; TTTATCGTGAGGTGCTACTGTGCTA
>probe:Drosophila_2:1634121_at:247:535; Interrogation_Position=492; Antisense; GGTGACTTGTCTAACTGAAAGCTTC
>probe:Drosophila_2:1634121_at:70:657; Interrogation_Position=571; Antisense; TAATCGGTCTAAAACTGGTCAAGCA
>probe:Drosophila_2:1634121_at:146:339; Interrogation_Position=67; Antisense; GCTAGGAAAACCCATGTCCATATTT

Paste this into a BLAST search page for me
TAATATGTATCTTGACTGTCAGCGTGTCAGCGTGGTCTCCATACAGAGTCACAGAGTCTCTCACTTCTGGAGGAAATTACGTGTCAGATTGCCTGGCCAGAGAACCGCCTTTCTGCGAGTAACAGGAATTCCAGGAACTCATCGATCGCAATCGATCGCAACAGCTCCGAAGAGGGAGGATGACCTCGAGAATACCGACAAAATGCTTCATCCATTGCCTAGCGGATTGAGCCCGTGAGCGATGAACTGCTTTATCGTGAGGTGCTACTGTGCTAGGTGACTTGTCTAACTGAAAGCTTCTAATCGGTCTAAAACTGGTCAAGCAGCTAGGAAAACCCATGTCCATATTT

Full Affymetrix probeset data:

Annotations for 1634121_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime