Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634122_at:

>probe:Drosophila_2:1634122_at:443:85; Interrogation_Position=1005; Antisense; AGTGATGTTCTCTATCTGCTGCAGC
>probe:Drosophila_2:1634122_at:717:31; Interrogation_Position=1041; Antisense; ATCAGTCGCCGTAAGAATACCCAGG
>probe:Drosophila_2:1634122_at:560:207; Interrogation_Position=1080; Antisense; AAGCTGTTCGCTTTGGCCAGCGGAA
>probe:Drosophila_2:1634122_at:523:3; Interrogation_Position=1112; Antisense; ATTGGATCGCACCAAACTGGCGCAA
>probe:Drosophila_2:1634122_at:62:117; Interrogation_Position=630; Antisense; AGCATTGCCAAATTCTCCGATATAT
>probe:Drosophila_2:1634122_at:442:683; Interrogation_Position=652; Antisense; TATGCAAGAAAACTCCGTCTCCGTG
>probe:Drosophila_2:1634122_at:382:305; Interrogation_Position=672; Antisense; CCGTGCCTGCACTACAATTTGTGGA
>probe:Drosophila_2:1634122_at:220:521; Interrogation_Position=692; Antisense; GTGGAACATACTAAGCGCCTACGCC
>probe:Drosophila_2:1634122_at:149:37; Interrogation_Position=784; Antisense; ATCTCAGCGCCACCTTAAAGTACGG
>probe:Drosophila_2:1634122_at:393:489; Interrogation_Position=803; Antisense; GTACGGCACCAACTTCGAGGATGCT
>probe:Drosophila_2:1634122_at:714:73; Interrogation_Position=829; Antisense; AGGACGCTATTGTCTCCGTAGAGAT
>probe:Drosophila_2:1634122_at:711:243; Interrogation_Position=921; Antisense; AATTTCCTCGTCGACAACAGGGAGC
>probe:Drosophila_2:1634122_at:271:51; Interrogation_Position=958; Antisense; ATGCCCGCCAGTTGATGGCTACGAA
>probe:Drosophila_2:1634122_at:284:215; Interrogation_Position=990; Antisense; AAGTTGGCCGCCCTTAGTGATGTTC

Paste this into a BLAST search page for me
AGTGATGTTCTCTATCTGCTGCAGCATCAGTCGCCGTAAGAATACCCAGGAAGCTGTTCGCTTTGGCCAGCGGAAATTGGATCGCACCAAACTGGCGCAAAGCATTGCCAAATTCTCCGATATATTATGCAAGAAAACTCCGTCTCCGTGCCGTGCCTGCACTACAATTTGTGGAGTGGAACATACTAAGCGCCTACGCCATCTCAGCGCCACCTTAAAGTACGGGTACGGCACCAACTTCGAGGATGCTAGGACGCTATTGTCTCCGTAGAGATAATTTCCTCGTCGACAACAGGGAGCATGCCCGCCAGTTGATGGCTACGAAAAGTTGGCCGCCCTTAGTGATGTTC

Full Affymetrix probeset data:

Annotations for 1634122_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime