Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634123_at:

>probe:Drosophila_2:1634123_at:494:311; Interrogation_Position=3002; Antisense; GTCAGTTCCCCGAGGACTACAACGG
>probe:Drosophila_2:1634123_at:449:557; Interrogation_Position=3015; Antisense; GGACTACAACGGACCTATTGTGGAT
>probe:Drosophila_2:1634123_at:471:375; Interrogation_Position=3127; Antisense; GAAGAAGCACCATCTACTCTACCTG
>probe:Drosophila_2:1634123_at:355:667; Interrogation_Position=3141; Antisense; TACTCTACCTGCGTTGCCCAAAAAT
>probe:Drosophila_2:1634123_at:170:539; Interrogation_Position=3187; Antisense; GGTAGCGGAATAAATGCCCAGGTCT
>probe:Drosophila_2:1634123_at:548:623; Interrogation_Position=3201; Antisense; TGCCCAGGTCTATGAGCAAAGCTCT
>probe:Drosophila_2:1634123_at:661:467; Interrogation_Position=3258; Antisense; TGATATTTCGGAGCGTGGGACCTAC
>probe:Drosophila_2:1634123_at:124:527; Interrogation_Position=3274; Antisense; GGGACCTACGATACGTACGACCAGA
>probe:Drosophila_2:1634123_at:130:413; Interrogation_Position=3297; Antisense; GACCGCACCCACAACTATAATGGCA
>probe:Drosophila_2:1634123_at:715:347; Interrogation_Position=3342; Antisense; GCAGTCCTTTGTCCTTAAACCAATC
>probe:Drosophila_2:1634123_at:399:661; Interrogation_Position=3357; Antisense; TAAACCAATCGTAGTTTCCTCCACT
>probe:Drosophila_2:1634123_at:226:201; Interrogation_Position=3386; Antisense; AACCGCTGCCAGAGATTGATTTCGA
>probe:Drosophila_2:1634123_at:297:375; Interrogation_Position=3409; Antisense; GAAGTTGAGCCAACAGCTCCAGGCA
>probe:Drosophila_2:1634123_at:58:437; Interrogation_Position=3442; Antisense; GAGGAGGATCACCTGCAAAGTCTAA

Paste this into a BLAST search page for me
GTCAGTTCCCCGAGGACTACAACGGGGACTACAACGGACCTATTGTGGATGAAGAAGCACCATCTACTCTACCTGTACTCTACCTGCGTTGCCCAAAAATGGTAGCGGAATAAATGCCCAGGTCTTGCCCAGGTCTATGAGCAAAGCTCTTGATATTTCGGAGCGTGGGACCTACGGGACCTACGATACGTACGACCAGAGACCGCACCCACAACTATAATGGCAGCAGTCCTTTGTCCTTAAACCAATCTAAACCAATCGTAGTTTCCTCCACTAACCGCTGCCAGAGATTGATTTCGAGAAGTTGAGCCAACAGCTCCAGGCAGAGGAGGATCACCTGCAAAGTCTAA

Full Affymetrix probeset data:

Annotations for 1634123_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime