FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634124_at:

>probe:Drosophila_2:1634124_at:487:99; Interrogation_Position=374; Antisense; AGAGAACTCTAAGGCTACTGGTAAA
>probe:Drosophila_2:1634124_at:113:547; Interrogation_Position=399; Antisense; GGATCGCTATACCAAGATACTCTTA
>probe:Drosophila_2:1634124_at:464:215; Interrogation_Position=412; Antisense; AAGATACTCTTACTCCCCTGGAGGA
>probe:Drosophila_2:1634124_at:139:95; Interrogation_Position=440; Antisense; AGTTGCTGTAATCTGCGACCTGTAC
>probe:Drosophila_2:1634124_at:387:413; Interrogation_Position=456; Antisense; GACCTGTACGATATGGCAGACACCA
>probe:Drosophila_2:1634124_at:721:523; Interrogation_Position=488; Antisense; GGGCTGCCCCAAGGATCAAACTGAA
>probe:Drosophila_2:1634124_at:518:67; Interrogation_Position=513; Antisense; ATGGCCCACGGAGTTTCTTTGAAAT
>probe:Drosophila_2:1634124_at:591:177; Interrogation_Position=544; Antisense; AAACTGACCAAGACGATTCCAGGGT
>probe:Drosophila_2:1634124_at:572:419; Interrogation_Position=636; Antisense; GAGCATAGCGCTAACACTTCACAGA
>probe:Drosophila_2:1634124_at:251:469; Interrogation_Position=723; Antisense; GTTCCGGTCCTCTTGGGTATAGCAA
>probe:Drosophila_2:1634124_at:268:507; Interrogation_Position=757; Antisense; GTGACTTAAATAGACAATCCCGCTT
>probe:Drosophila_2:1634124_at:441:345; Interrogation_Position=813; Antisense; GCATTATTGGCTTTGAGTACGCAGA
>probe:Drosophila_2:1634124_at:332:457; Interrogation_Position=836; Antisense; GATAGCCGATTTAATGCAGCAGCAG
>probe:Drosophila_2:1634124_at:437:415; Interrogation_Position=867; Antisense; GAGCGTAAGCGTCTTAACGCCATAA

Paste this into a BLAST search page for me
AGAGAACTCTAAGGCTACTGGTAAAGGATCGCTATACCAAGATACTCTTAAAGATACTCTTACTCCCCTGGAGGAAGTTGCTGTAATCTGCGACCTGTACGACCTGTACGATATGGCAGACACCAGGGCTGCCCCAAGGATCAAACTGAAATGGCCCACGGAGTTTCTTTGAAATAAACTGACCAAGACGATTCCAGGGTGAGCATAGCGCTAACACTTCACAGAGTTCCGGTCCTCTTGGGTATAGCAAGTGACTTAAATAGACAATCCCGCTTGCATTATTGGCTTTGAGTACGCAGAGATAGCCGATTTAATGCAGCAGCAGGAGCGTAAGCGTCTTAACGCCATAA

Full Affymetrix probeset data:

Annotations for 1634124_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720