FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634125_at:

>probe:Drosophila_2:1634125_at:665:255; Interrogation_Position=2868; Antisense; CAAATTGGCTTAACAGAGTCCGTAA
>probe:Drosophila_2:1634125_at:340:217; Interrogation_Position=2914; Antisense; AAGTTTGGCTCAAAGGGCGCCAGGA
>probe:Drosophila_2:1634125_at:642:575; Interrogation_Position=2929; Antisense; GGCGCCAGGAAGTTTATACGTTGCA
>probe:Drosophila_2:1634125_at:285:139; Interrogation_Position=2946; Antisense; ACGTTGCAAGCATCGACAATCGGTG
>probe:Drosophila_2:1634125_at:572:671; Interrogation_Position=3043; Antisense; TAGCGAGGTACAACATACGGCATCA
>probe:Drosophila_2:1634125_at:114:29; Interrogation_Position=3057; Antisense; ATACGGCATCAAAGCCTATGGCAAA
>probe:Drosophila_2:1634125_at:116:15; Interrogation_Position=3105; Antisense; ATTACCCACTGTTCATTGAGGCGCA
>probe:Drosophila_2:1634125_at:353:289; Interrogation_Position=3130; Antisense; CGGAATGCTTTGAATTGCCTCTTAA
>probe:Drosophila_2:1634125_at:47:623; Interrogation_Position=3145; Antisense; TGCCTCTTAATGATTCCAACCGGAA
>probe:Drosophila_2:1634125_at:161:327; Interrogation_Position=3184; Antisense; GCGAGAAAACGTGCTTATCAGATCA
>probe:Drosophila_2:1634125_at:328:229; Interrogation_Position=3219; Antisense; AATGGTCCATCTGTTCAGGATCAAC
>probe:Drosophila_2:1634125_at:205:553; Interrogation_Position=3259; Antisense; GGAGCTCTGATTGTTCCGACATTGA
>probe:Drosophila_2:1634125_at:124:407; Interrogation_Position=3320; Antisense; GACTGGACAACCGAAACTTTTATGG
>probe:Drosophila_2:1634125_at:92:563; Interrogation_Position=3343; Antisense; GGAACCGATCAAGTAGTCATCAAGT

Paste this into a BLAST search page for me
CAAATTGGCTTAACAGAGTCCGTAAAAGTTTGGCTCAAAGGGCGCCAGGAGGCGCCAGGAAGTTTATACGTTGCAACGTTGCAAGCATCGACAATCGGTGTAGCGAGGTACAACATACGGCATCAATACGGCATCAAAGCCTATGGCAAAATTACCCACTGTTCATTGAGGCGCACGGAATGCTTTGAATTGCCTCTTAATGCCTCTTAATGATTCCAACCGGAAGCGAGAAAACGTGCTTATCAGATCAAATGGTCCATCTGTTCAGGATCAACGGAGCTCTGATTGTTCCGACATTGAGACTGGACAACCGAAACTTTTATGGGGAACCGATCAAGTAGTCATCAAGT

Full Affymetrix probeset data:

Annotations for 1634125_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720