FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634126_at:

>probe:Drosophila_2:1634126_at:92:383; Interrogation_Position=108; Antisense; GAACTTTCGCGATGTGAAACAGCGT
>probe:Drosophila_2:1634126_at:516:383; Interrogation_Position=151; Antisense; GAACTGGAGCAACATGGAGCCAAGT
>probe:Drosophila_2:1634126_at:228:387; Interrogation_Position=17; Antisense; GAAACATCTAAACTTCCATTTTTAT
>probe:Drosophila_2:1634126_at:26:533; Interrogation_Position=177; Antisense; GGGTCGCCTCATCGGCATCGAAGAT
>probe:Drosophila_2:1634126_at:228:315; Interrogation_Position=182; Antisense; GCCTCATCGGCATCGAAGATGGCAA
>probe:Drosophila_2:1634126_at:432:547; Interrogation_Position=207; Antisense; GGATGATGCTTTCATTCGTTTCATG
>probe:Drosophila_2:1634126_at:402:273; Interrogation_Position=219; Antisense; CATTCGTTTCATGAAGCAGAACATT
>probe:Drosophila_2:1634126_at:365:167; Interrogation_Position=266; Antisense; AAATGGCGTATTGCATGTTACCTTA
>probe:Drosophila_2:1634126_at:166:347; Interrogation_Position=278; Antisense; GCATGTTACCTTAAAGCCTGACAAG
>probe:Drosophila_2:1634126_at:32:317; Interrogation_Position=293; Antisense; GCCTGACAAGAATACACATGTTCAA
>probe:Drosophila_2:1634126_at:242:165; Interrogation_Position=324; Antisense; AAATGCATTACTTTGCGTAAACAAT
>probe:Drosophila_2:1634126_at:515:151; Interrogation_Position=59; Antisense; ACATCATAATGTTTGAGTCTTTCGA
>probe:Drosophila_2:1634126_at:159:427; Interrogation_Position=73; Antisense; GAGTCTTTCGATTGGACCTTGGGAT
>probe:Drosophila_2:1634126_at:215:5; Interrogation_Position=83; Antisense; ATTGGACCTTGGGATTAGATTTGAA

Paste this into a BLAST search page for me
GAACTTTCGCGATGTGAAACAGCGTGAACTGGAGCAACATGGAGCCAAGTGAAACATCTAAACTTCCATTTTTATGGGTCGCCTCATCGGCATCGAAGATGCCTCATCGGCATCGAAGATGGCAAGGATGATGCTTTCATTCGTTTCATGCATTCGTTTCATGAAGCAGAACATTAAATGGCGTATTGCATGTTACCTTAGCATGTTACCTTAAAGCCTGACAAGGCCTGACAAGAATACACATGTTCAAAAATGCATTACTTTGCGTAAACAATACATCATAATGTTTGAGTCTTTCGAGAGTCTTTCGATTGGACCTTGGGATATTGGACCTTGGGATTAGATTTGAA

Full Affymetrix probeset data:

Annotations for 1634126_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720