FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634128_at:

>probe:Drosophila_2:1634128_at:309:599; Interrogation_Position=128; Antisense; TGTCCCGCACCAAGATTCACATAAT
>probe:Drosophila_2:1634128_at:701:583; Interrogation_Position=14; Antisense; TGGAAGCCCAACGTAACAACGCCAA
>probe:Drosophila_2:1634128_at:319:655; Interrogation_Position=149; Antisense; TAATCGATGGACTGGTGTCCCGCAC
>probe:Drosophila_2:1634128_at:145:47; Interrogation_Position=175; Antisense; ATCCGCCACATGAAGCACTGCAGCA
>probe:Drosophila_2:1634128_at:487:209; Interrogation_Position=187; Antisense; AAGCACTGCAGCATGGAGGATCTGA
>probe:Drosophila_2:1634128_at:700:453; Interrogation_Position=253; Antisense; GATCAGCTCAAGAACATGCGACGCA
>probe:Drosophila_2:1634128_at:561:627; Interrogation_Position=286; Antisense; TCCTCCGTCAACAAAGTCGATGCTA
>probe:Drosophila_2:1634128_at:465:171; Interrogation_Position=298; Antisense; AAAGTCGATGCTAGTGCCAACACAT
>probe:Drosophila_2:1634128_at:528:467; Interrogation_Position=331; Antisense; GTTGTGAGTGTCAAGGCGCCATGCA
>probe:Drosophila_2:1634128_at:655:391; Interrogation_Position=363; Antisense; GAAACCTCGATCCTCCACAGGAGAG
>probe:Drosophila_2:1634128_at:162:215; Interrogation_Position=394; Antisense; AAGATGGACATCTTCGGACCGGAGA
>probe:Drosophila_2:1634128_at:276:639; Interrogation_Position=407; Antisense; TCGGACCGGAGATCTTCGTTTAAGT
>probe:Drosophila_2:1634128_at:723:413; Interrogation_Position=60; Antisense; GAGCGTGGGCTATCTACTTTTTCAG
>probe:Drosophila_2:1634128_at:577:667; Interrogation_Position=74; Antisense; TACTTTTTCAGTACCAGAGCGAGCT

Paste this into a BLAST search page for me
TGTCCCGCACCAAGATTCACATAATTGGAAGCCCAACGTAACAACGCCAATAATCGATGGACTGGTGTCCCGCACATCCGCCACATGAAGCACTGCAGCAAAGCACTGCAGCATGGAGGATCTGAGATCAGCTCAAGAACATGCGACGCATCCTCCGTCAACAAAGTCGATGCTAAAAGTCGATGCTAGTGCCAACACATGTTGTGAGTGTCAAGGCGCCATGCAGAAACCTCGATCCTCCACAGGAGAGAAGATGGACATCTTCGGACCGGAGATCGGACCGGAGATCTTCGTTTAAGTGAGCGTGGGCTATCTACTTTTTCAGTACTTTTTCAGTACCAGAGCGAGCT

Full Affymetrix probeset data:

Annotations for 1634128_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720