Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634129_at:

>probe:Drosophila_2:1634129_at:482:125; Interrogation_Position=2483; Antisense; AGCCCCTGGCTTGCAATGAGCTCTA
>probe:Drosophila_2:1634129_at:674:231; Interrogation_Position=2497; Antisense; AATGAGCTCTACTGCCACCTGAGGC
>probe:Drosophila_2:1634129_at:334:181; Interrogation_Position=2539; Antisense; AAAAGTCTGGACATGGCCAACGGAA
>probe:Drosophila_2:1634129_at:400:195; Interrogation_Position=2557; Antisense; AACGGAAACTATACACTTGCCCTCA
>probe:Drosophila_2:1634129_at:298:281; Interrogation_Position=2578; Antisense; CTCATCTTTCTGTTCGGCGTTTTGG
>probe:Drosophila_2:1634129_at:568:47; Interrogation_Position=2614; Antisense; ATCCTGGCGTTCTACATCATGTCCT
>probe:Drosophila_2:1634129_at:178:629; Interrogation_Position=2635; Antisense; TCCTTCCGCCTCAGATTGTTCAGAT
>probe:Drosophila_2:1634129_at:351:465; Interrogation_Position=2648; Antisense; GATTGTTCAGATGAGACCCACGTCT
>probe:Drosophila_2:1634129_at:631:323; Interrogation_Position=2676; Antisense; GCGACCAAAGGAAACCTGCCACATT
>probe:Drosophila_2:1634129_at:462:273; Interrogation_Position=2697; Antisense; CATTCCGCCGACAGTTAAATGTTTT
>probe:Drosophila_2:1634129_at:244:187; Interrogation_Position=2827; Antisense; AACACAGGATCATAGAGCCCTCACA
>probe:Drosophila_2:1634129_at:714:395; Interrogation_Position=2870; Antisense; GACAAGCATACACACACGGCGGTAA
>probe:Drosophila_2:1634129_at:153:573; Interrogation_Position=2887; Antisense; GGCGGTAACCGAGATCAATAATTGT
>probe:Drosophila_2:1634129_at:306:605; Interrogation_Position=3001; Antisense; TGATTTTCAGGCGTCAGCTGCGAGT

Paste this into a BLAST search page for me
AGCCCCTGGCTTGCAATGAGCTCTAAATGAGCTCTACTGCCACCTGAGGCAAAAGTCTGGACATGGCCAACGGAAAACGGAAACTATACACTTGCCCTCACTCATCTTTCTGTTCGGCGTTTTGGATCCTGGCGTTCTACATCATGTCCTTCCTTCCGCCTCAGATTGTTCAGATGATTGTTCAGATGAGACCCACGTCTGCGACCAAAGGAAACCTGCCACATTCATTCCGCCGACAGTTAAATGTTTTAACACAGGATCATAGAGCCCTCACAGACAAGCATACACACACGGCGGTAAGGCGGTAACCGAGATCAATAATTGTTGATTTTCAGGCGTCAGCTGCGAGT

Full Affymetrix probeset data:

Annotations for 1634129_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime