FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634133_at:

>probe:Drosophila_2:1634133_at:728:467; Interrogation_Position=1020; Antisense; GTTGTTCTAGTGATTTTGCTGCCAT
>probe:Drosophila_2:1634133_at:461:219; Interrogation_Position=1080; Antisense; AAGTGACTCAATCTGCAAGTTTGTT
>probe:Drosophila_2:1634133_at:39:171; Interrogation_Position=668; Antisense; AAAGAGTCGCCGGAAACGCCATTCT
>probe:Drosophila_2:1634133_at:236:559; Interrogation_Position=679; Antisense; GGAAACGCCATTCTTCTACGGCGAT
>probe:Drosophila_2:1634133_at:531:575; Interrogation_Position=698; Antisense; GGCGATCAGCCCTGCGAACTGGACG
>probe:Drosophila_2:1634133_at:142:583; Interrogation_Position=774; Antisense; TGGCGCTGGCCCAAACGGTGCAGAA
>probe:Drosophila_2:1634133_at:725:373; Interrogation_Position=796; Antisense; GAAGTTCCAGCACTTGGTCGAGTTC
>probe:Drosophila_2:1634133_at:400:93; Interrogation_Position=816; Antisense; AGTTCTGTCGCTTCGTCGATGAGAA
>probe:Drosophila_2:1634133_at:583:371; Interrogation_Position=838; Antisense; GAAGTACTTTCAGACGAGGTGCCTA
>probe:Drosophila_2:1634133_at:438:435; Interrogation_Position=853; Antisense; GAGGTGCCTACCAAATTAGTTATAC
>probe:Drosophila_2:1634133_at:372:679; Interrogation_Position=879; Antisense; TAGTCGTTGCCTTAAATGCTTATCA
>probe:Drosophila_2:1634133_at:519:617; Interrogation_Position=911; Antisense; TGCTCTTGTCCTTTCTTTTTAACCG
>probe:Drosophila_2:1634133_at:134:625; Interrogation_Position=956; Antisense; TGCCCTTAAAACAAATCGTCGCCGT
>probe:Drosophila_2:1634133_at:295:43; Interrogation_Position=970; Antisense; ATCGTCGCCGTAAGTCACAATTATT

Paste this into a BLAST search page for me
GTTGTTCTAGTGATTTTGCTGCCATAAGTGACTCAATCTGCAAGTTTGTTAAAGAGTCGCCGGAAACGCCATTCTGGAAACGCCATTCTTCTACGGCGATGGCGATCAGCCCTGCGAACTGGACGTGGCGCTGGCCCAAACGGTGCAGAAGAAGTTCCAGCACTTGGTCGAGTTCAGTTCTGTCGCTTCGTCGATGAGAAGAAGTACTTTCAGACGAGGTGCCTAGAGGTGCCTACCAAATTAGTTATACTAGTCGTTGCCTTAAATGCTTATCATGCTCTTGTCCTTTCTTTTTAACCGTGCCCTTAAAACAAATCGTCGCCGTATCGTCGCCGTAAGTCACAATTATT

Full Affymetrix probeset data:

Annotations for 1634133_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720