Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634134_at:

>probe:Drosophila_2:1634134_at:266:177; Interrogation_Position=5070; Antisense; AAACGATTCGCATACTTATTAAAAT
>probe:Drosophila_2:1634134_at:584:493; Interrogation_Position=5106; Antisense; GTAATGTTGTGTATTGTACTACGCT
>probe:Drosophila_2:1634134_at:473:599; Interrogation_Position=5120; Antisense; TGTACTACGCTTTTTACGTTGTTGT
>probe:Drosophila_2:1634134_at:109:703; Interrogation_Position=5150; Antisense; TTTTCCCCTGCGTTTCAACATAATA
>probe:Drosophila_2:1634134_at:393:91; Interrogation_Position=5191; Antisense; AGTTCTGCAAGTGATTACGGCTAAG
>probe:Drosophila_2:1634134_at:568:657; Interrogation_Position=5212; Antisense; TAAGTTAAATACTGCATTGTGCGCT
>probe:Drosophila_2:1634134_at:204:345; Interrogation_Position=5225; Antisense; GCATTGTGCGCTTTGTTTTGTATCT
>probe:Drosophila_2:1634134_at:170:299; Interrogation_Position=5233; Antisense; CGCTTTGTTTTGTATCTTCGGATAT
>probe:Drosophila_2:1634134_at:458:697; Interrogation_Position=5288; Antisense; TTTAAGCTTGAGGAATCGCGTCTGA
>probe:Drosophila_2:1634134_at:179:367; Interrogation_Position=5300; Antisense; GAATCGCGTCTGAGGTGGATGAATT
>probe:Drosophila_2:1634134_at:421:589; Interrogation_Position=5315; Antisense; TGGATGAATTGCAGCCAGGCCGAGA
>probe:Drosophila_2:1634134_at:39:579; Interrogation_Position=5332; Antisense; GGCCGAGATCGAACCATACAAGAGA
>probe:Drosophila_2:1634134_at:175:255; Interrogation_Position=5431; Antisense; CAAAGTGGCATCTGTTATTAGGTTA
>probe:Drosophila_2:1634134_at:185:181; Interrogation_Position=5531; Antisense; AAACAAACCGTGAACAGACAAGCAA

Paste this into a BLAST search page for me
AAACGATTCGCATACTTATTAAAATGTAATGTTGTGTATTGTACTACGCTTGTACTACGCTTTTTACGTTGTTGTTTTTCCCCTGCGTTTCAACATAATAAGTTCTGCAAGTGATTACGGCTAAGTAAGTTAAATACTGCATTGTGCGCTGCATTGTGCGCTTTGTTTTGTATCTCGCTTTGTTTTGTATCTTCGGATATTTTAAGCTTGAGGAATCGCGTCTGAGAATCGCGTCTGAGGTGGATGAATTTGGATGAATTGCAGCCAGGCCGAGAGGCCGAGATCGAACCATACAAGAGACAAAGTGGCATCTGTTATTAGGTTAAAACAAACCGTGAACAGACAAGCAA

Full Affymetrix probeset data:

Annotations for 1634134_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime