Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634135_at:

>probe:Drosophila_2:1634135_at:511:177; Interrogation_Position=132; Antisense; AAACATGCACATGCCAACCTACGGA
>probe:Drosophila_2:1634135_at:446:199; Interrogation_Position=147; Antisense; AACCTACGGAGCTTTCGAGACGACG
>probe:Drosophila_2:1634135_at:165:351; Interrogation_Position=16; Antisense; GCAGATACCCGTAAAGACGCCGCGC
>probe:Drosophila_2:1634135_at:113:497; Interrogation_Position=175; Antisense; GTCAGCGTGGTGATTCAGCCTGCTC
>probe:Drosophila_2:1634135_at:66:51; Interrogation_Position=208; Antisense; ATGCCCACCGAGATCATCGTGATTG
>probe:Drosophila_2:1634135_at:434:447; Interrogation_Position=236; Antisense; GATGCCCTGCATGTCGGATTGGATA
>probe:Drosophila_2:1634135_at:428:721; Interrogation_Position=254; Antisense; TTGGATACCTGGAGGACACCTTCTC
>probe:Drosophila_2:1634135_at:453:239; Interrogation_Position=300; Antisense; AATCTTCTTCTTCCCGCTGGGAATT
>probe:Drosophila_2:1634135_at:364:331; Interrogation_Position=315; Antisense; GCTGGGAATTCTCTGTTGCTTGGCC
>probe:Drosophila_2:1634135_at:61:329; Interrogation_Position=342; Antisense; GCGTGAGAAGCGCTGTTCCAACTGC
>probe:Drosophila_2:1634135_at:580:599; Interrogation_Position=357; Antisense; TTCCAACTGCGGAACGGTTTTCTAG
>probe:Drosophila_2:1634135_at:29:301; Interrogation_Position=38; Antisense; CGCCGCCGAGCTACGAAGAAGTCAT
>probe:Drosophila_2:1634135_at:177:211; Interrogation_Position=53; Antisense; AAGAAGTCATGAACAGTCCCTCGCA
>probe:Drosophila_2:1634135_at:224:9; Interrogation_Position=80; Antisense; ATTCCCGGCTGATAGTGGGCGTGCA

Paste this into a BLAST search page for me
AAACATGCACATGCCAACCTACGGAAACCTACGGAGCTTTCGAGACGACGGCAGATACCCGTAAAGACGCCGCGCGTCAGCGTGGTGATTCAGCCTGCTCATGCCCACCGAGATCATCGTGATTGGATGCCCTGCATGTCGGATTGGATATTGGATACCTGGAGGACACCTTCTCAATCTTCTTCTTCCCGCTGGGAATTGCTGGGAATTCTCTGTTGCTTGGCCGCGTGAGAAGCGCTGTTCCAACTGCTTCCAACTGCGGAACGGTTTTCTAGCGCCGCCGAGCTACGAAGAAGTCATAAGAAGTCATGAACAGTCCCTCGCAATTCCCGGCTGATAGTGGGCGTGCA

Full Affymetrix probeset data:

Annotations for 1634135_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime