Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634136_at:

>probe:Drosophila_2:1634136_at:669:325; Interrogation_Position=409; Antisense; GCGTTGGCGTGGACAGCTACTACAA
>probe:Drosophila_2:1634136_at:278:669; Interrogation_Position=426; Antisense; TACTACAATCCGTACAGCTCGCGAG
>probe:Drosophila_2:1634136_at:720:281; Interrogation_Position=443; Antisense; CTCGCGAGCTCTGGGTGGATTAGAT
>probe:Drosophila_2:1634136_at:661:27; Interrogation_Position=485; Antisense; ATACGGAGGCTATGGATCCACTCTG
>probe:Drosophila_2:1634136_at:528:65; Interrogation_Position=496; Antisense; ATGGATCCACTCTGGGCGGCTATGG
>probe:Drosophila_2:1634136_at:625:277; Interrogation_Position=547; Antisense; CTCTTGGTGGCTATGGATCGGGACT
>probe:Drosophila_2:1634136_at:609:703; Interrogation_Position=578; Antisense; TTATGGTGGCTCCTACAACTCGAAT
>probe:Drosophila_2:1634136_at:498:599; Interrogation_Position=613; Antisense; TGTCATACTACAACAGCAGGCTGGG
>probe:Drosophila_2:1634136_at:392:567; Interrogation_Position=648; Antisense; GGCACTGGGTATCCGTACTACAACA
>probe:Drosophila_2:1634136_at:243:533; Interrogation_Position=687; Antisense; GGTGGCTATCCATCCAGTTACTATA
>probe:Drosophila_2:1634136_at:313:687; Interrogation_Position=708; Antisense; TATACGAGCAACTATGGCAACAGCG
>probe:Drosophila_2:1634136_at:676:41; Interrogation_Position=774; Antisense; ATCGGATCGGGCTATAACTACGGTT
>probe:Drosophila_2:1634136_at:348:565; Interrogation_Position=801; Antisense; GGAATCTCGGGAACCGTCTACTAGA
>probe:Drosophila_2:1634136_at:507:353; Interrogation_Position=830; Antisense; GCACGGTCCAACGTTCAAGATCTAA

Paste this into a BLAST search page for me
GCGTTGGCGTGGACAGCTACTACAATACTACAATCCGTACAGCTCGCGAGCTCGCGAGCTCTGGGTGGATTAGATATACGGAGGCTATGGATCCACTCTGATGGATCCACTCTGGGCGGCTATGGCTCTTGGTGGCTATGGATCGGGACTTTATGGTGGCTCCTACAACTCGAATTGTCATACTACAACAGCAGGCTGGGGGCACTGGGTATCCGTACTACAACAGGTGGCTATCCATCCAGTTACTATATATACGAGCAACTATGGCAACAGCGATCGGATCGGGCTATAACTACGGTTGGAATCTCGGGAACCGTCTACTAGAGCACGGTCCAACGTTCAAGATCTAA

Full Affymetrix probeset data:

Annotations for 1634136_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime