Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634138_at:

>probe:Drosophila_2:1634138_at:718:241; Interrogation_Position=1078; Antisense; AATATGGAGGGCTTAGGCACTTCGC
>probe:Drosophila_2:1634138_at:633:711; Interrogation_Position=1120; Antisense; TTCACATCGATTGTATACCTCCCAG
>probe:Drosophila_2:1634138_at:90:429; Interrogation_Position=1148; Antisense; GAGTTGCTATCCTCTTGTTGCAGAA
>probe:Drosophila_2:1634138_at:570:215; Interrogation_Position=1174; Antisense; AAGATCGGACGCAAGGGCATGGCCT
>probe:Drosophila_2:1634138_at:295:585; Interrogation_Position=1218; Antisense; TGGACTTATTACCACGGCGACGGGT
>probe:Drosophila_2:1634138_at:594:539; Interrogation_Position=1240; Antisense; GGTTTCATGATAGCCCACTTGGATC
>probe:Drosophila_2:1634138_at:524:107; Interrogation_Position=1271; Antisense; AGAACGCCCTGCTGTTGGCTATCAT
>probe:Drosophila_2:1634138_at:536:499; Interrogation_Position=1301; Antisense; GTCTGGGACGATTTGGAGCCACCGT
>probe:Drosophila_2:1634138_at:229:127; Interrogation_Position=1317; Antisense; AGCCACCGTTTCCTACGATGCGGAA
>probe:Drosophila_2:1634138_at:602:69; Interrogation_Position=1385; Antisense; AGGCGGTATCCAACATCCATGTCAT
>probe:Drosophila_2:1634138_at:652:637; Interrogation_Position=1477; Antisense; TCGATCTTCATTAGCTGCCTGATGT
>probe:Drosophila_2:1634138_at:680:315; Interrogation_Position=1493; Antisense; GCCTGATGTTCTTTGGAGCTGGACT
>probe:Drosophila_2:1634138_at:152:545; Interrogation_Position=1513; Antisense; GGACTTTGTCTCACTTTACCGGAGA
>probe:Drosophila_2:1634138_at:128:481; Interrogation_Position=1581; Antisense; GTTTGCCTTGAACGAGAGCTTCCTC

Paste this into a BLAST search page for me
AATATGGAGGGCTTAGGCACTTCGCTTCACATCGATTGTATACCTCCCAGGAGTTGCTATCCTCTTGTTGCAGAAAAGATCGGACGCAAGGGCATGGCCTTGGACTTATTACCACGGCGACGGGTGGTTTCATGATAGCCCACTTGGATCAGAACGCCCTGCTGTTGGCTATCATGTCTGGGACGATTTGGAGCCACCGTAGCCACCGTTTCCTACGATGCGGAAAGGCGGTATCCAACATCCATGTCATTCGATCTTCATTAGCTGCCTGATGTGCCTGATGTTCTTTGGAGCTGGACTGGACTTTGTCTCACTTTACCGGAGAGTTTGCCTTGAACGAGAGCTTCCTC

Full Affymetrix probeset data:

Annotations for 1634138_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime