FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634139_at:

>probe:Drosophila_2:1634139_at:222:709; Interrogation_Position=1351; Antisense; TTAAAGCGACTACTTCCGGATCCAA
>probe:Drosophila_2:1634139_at:474:247; Interrogation_Position=1389; Antisense; AATTCCGCTGCTTGATCAGATGCAC
>probe:Drosophila_2:1634139_at:387:81; Interrogation_Position=1436; Antisense; AGGTGTTCCGCATGTACAGCACGGT
>probe:Drosophila_2:1634139_at:20:561; Interrogation_Position=1465; Antisense; GGAAACGGACGAACTCTCATGGAGG
>probe:Drosophila_2:1634139_at:361:557; Interrogation_Position=1488; Antisense; GGACAGTGTCATCTGTGGCTACCAG
>probe:Drosophila_2:1634139_at:399:495; Interrogation_Position=1534; Antisense; GTCTTTCCGACTATTGTCACGGGTA
>probe:Drosophila_2:1634139_at:191:431; Interrogation_Position=1567; Antisense; GAGTATGTCACGGATGCAGCCACTT
>probe:Drosophila_2:1634139_at:574:155; Interrogation_Position=1617; Antisense; ACAGCATGGTGGTACTCCGGGCAAA
>probe:Drosophila_2:1634139_at:3:627; Interrogation_Position=1661; Antisense; TGCCTTACGGCTATGGAGCTCGGAT
>probe:Drosophila_2:1634139_at:456:499; Interrogation_Position=1694; Antisense; GTCGTCGATTCGCTGATCTGGAGAT
>probe:Drosophila_2:1634139_at:563:27; Interrogation_Position=1723; Antisense; ATACTGCTGGCCAAGCTACTACGAA
>probe:Drosophila_2:1634139_at:308:431; Interrogation_Position=1759; Antisense; GAGTACAACCACAAGCCACTGGATT
>probe:Drosophila_2:1634139_at:185:543; Interrogation_Position=1779; Antisense; GGATTACGCAGTCACTTTCATGTAC
>probe:Drosophila_2:1634139_at:462:555; Interrogation_Position=1813; Antisense; GGACCGCTGCGCTTTAAGATGACAC

Paste this into a BLAST search page for me
TTAAAGCGACTACTTCCGGATCCAAAATTCCGCTGCTTGATCAGATGCACAGGTGTTCCGCATGTACAGCACGGTGGAAACGGACGAACTCTCATGGAGGGGACAGTGTCATCTGTGGCTACCAGGTCTTTCCGACTATTGTCACGGGTAGAGTATGTCACGGATGCAGCCACTTACAGCATGGTGGTACTCCGGGCAAATGCCTTACGGCTATGGAGCTCGGATGTCGTCGATTCGCTGATCTGGAGATATACTGCTGGCCAAGCTACTACGAAGAGTACAACCACAAGCCACTGGATTGGATTACGCAGTCACTTTCATGTACGGACCGCTGCGCTTTAAGATGACAC

Full Affymetrix probeset data:

Annotations for 1634139_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720