FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634142_at:

>probe:Drosophila_2:1634142_at:262:325; Interrogation_Position=131; Antisense; GCGATGCCAGCGAAGTTTGCCAGTC
>probe:Drosophila_2:1634142_at:488:371; Interrogation_Position=189; Antisense; GAAGTTCTACTTCTGCCTGGACGGC
>probe:Drosophila_2:1634142_at:107:81; Interrogation_Position=215; Antisense; AGGTGATAGCCGACGAATGCGACTC
>probe:Drosophila_2:1634142_at:58:405; Interrogation_Position=235; Antisense; GACTCGGGATACTATTTCGTGAACA
>probe:Drosophila_2:1634142_at:343:607; Interrogation_Position=293; Antisense; TGATGAAGCCCTCCTGTGTGAACCT
>probe:Drosophila_2:1634142_at:176:441; Interrogation_Position=376; Antisense; GATGTGGCCAGCTTCTATCTGTGCA
>probe:Drosophila_2:1634142_at:437:683; Interrogation_Position=391; Antisense; TATCTGTGCACCAGCGAGGGAGCCA
>probe:Drosophila_2:1634142_at:301:501; Interrogation_Position=423; Antisense; GTCGTGTCCCGATGGCAAGGCGTTC
>probe:Drosophila_2:1634142_at:492:227; Interrogation_Position=439; Antisense; AAGGCGTTCGTCTCCCAGGATGGCT
>probe:Drosophila_2:1634142_at:636:67; Interrogation_Position=458; Antisense; ATGGCTATCTGGGATGCTTCGCGTG
>probe:Drosophila_2:1634142_at:4:633; Interrogation_Position=484; Antisense; TCCGAGTGGCGTTCGTTGCGTAACT
>probe:Drosophila_2:1634142_at:512:723; Interrogation_Position=499; Antisense; TTGCGTAACTGCGTCGACGACTGAT
>probe:Drosophila_2:1634142_at:93:655; Interrogation_Position=543; Antisense; TAATTATAGTTCATCCATCGCCATC
>probe:Drosophila_2:1634142_at:388:113; Interrogation_Position=69; Antisense; AGCACTCATCATTTTCTTTGGCATC

Paste this into a BLAST search page for me
GCGATGCCAGCGAAGTTTGCCAGTCGAAGTTCTACTTCTGCCTGGACGGCAGGTGATAGCCGACGAATGCGACTCGACTCGGGATACTATTTCGTGAACATGATGAAGCCCTCCTGTGTGAACCTGATGTGGCCAGCTTCTATCTGTGCATATCTGTGCACCAGCGAGGGAGCCAGTCGTGTCCCGATGGCAAGGCGTTCAAGGCGTTCGTCTCCCAGGATGGCTATGGCTATCTGGGATGCTTCGCGTGTCCGAGTGGCGTTCGTTGCGTAACTTTGCGTAACTGCGTCGACGACTGATTAATTATAGTTCATCCATCGCCATCAGCACTCATCATTTTCTTTGGCATC

Full Affymetrix probeset data:

Annotations for 1634142_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720