FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634143_at:

>probe:Drosophila_2:1634143_at:489:97; Interrogation_Position=1087; Antisense; AGATGCCCTACCTATCTCAGGTTGT
>probe:Drosophila_2:1634143_at:184:599; Interrogation_Position=1109; Antisense; TGTCAACGAGACACTCCGCAAGTAT
>probe:Drosophila_2:1634143_at:481:361; Interrogation_Position=1126; Antisense; GCAAGTATCCGATCGTGGGCTATAT
>probe:Drosophila_2:1634143_at:22:199; Interrogation_Position=1153; Antisense; AACGAGAATGCTCTCAACCGGCGGA
>probe:Drosophila_2:1634143_at:452:303; Interrogation_Position=1221; Antisense; CCGCACGGCATGTCCATTTATATGT
>probe:Drosophila_2:1634143_at:49:703; Interrogation_Position=1238; Antisense; TTATATGTCCACTGTGGCCGTTCAT
>probe:Drosophila_2:1634143_at:237:421; Interrogation_Position=1319; Antisense; GAGCAACCGCGACAATCTTAACATG
>probe:Drosophila_2:1634143_at:308:29; Interrogation_Position=1349; Antisense; ATACATGCCGTTTGGTGTTGGTCCG
>probe:Drosophila_2:1634143_at:653:729; Interrogation_Position=1366; Antisense; TTGGTCCGCGAAACTGCATTGGCAT
>probe:Drosophila_2:1634143_at:579:47; Interrogation_Position=1389; Antisense; ATGCGGTTGGGTCTGCTTCAATCCA
>probe:Drosophila_2:1634143_at:437:597; Interrogation_Position=1424; Antisense; TGTGCATATTTTGCGCAACCACCGA
>probe:Drosophila_2:1634143_at:665:539; Interrogation_Position=1502; Antisense; GGTTATGGCCTCAAAGCGCGATATT
>probe:Drosophila_2:1634143_at:453:123; Interrogation_Position=1516; Antisense; AGCGCGATATTATCCTTCGAGTGGA
>probe:Drosophila_2:1634143_at:239:677; Interrogation_Position=1587; Antisense; TAGAATTCATAACACAGCAGCCGCC

Paste this into a BLAST search page for me
AGATGCCCTACCTATCTCAGGTTGTTGTCAACGAGACACTCCGCAAGTATGCAAGTATCCGATCGTGGGCTATATAACGAGAATGCTCTCAACCGGCGGACCGCACGGCATGTCCATTTATATGTTTATATGTCCACTGTGGCCGTTCATGAGCAACCGCGACAATCTTAACATGATACATGCCGTTTGGTGTTGGTCCGTTGGTCCGCGAAACTGCATTGGCATATGCGGTTGGGTCTGCTTCAATCCATGTGCATATTTTGCGCAACCACCGAGGTTATGGCCTCAAAGCGCGATATTAGCGCGATATTATCCTTCGAGTGGATAGAATTCATAACACAGCAGCCGCC

Full Affymetrix probeset data:

Annotations for 1634143_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720