Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634145_s_at:

>probe:Drosophila_2:1634145_s_at:31:347; Interrogation_Position=413; Antisense; GCATCAATCACTGGAGCTATCCCAT
>probe:Drosophila_2:1634145_s_at:209:43; Interrogation_Position=436; Antisense; ATCGACACGATCTCGTATGGCGTTC
>probe:Drosophila_2:1634145_s_at:529:677; Interrogation_Position=451; Antisense; TATGGCGTTCAGGACCTGGTCTACA
>probe:Drosophila_2:1634145_s_at:438:161; Interrogation_Position=475; Antisense; ACAAGGGTCTTTGCCATGATCGTGG
>probe:Drosophila_2:1634145_s_at:484:427; Interrogation_Position=513; Antisense; GAGTCCGCATCCCTTTGAGGTTCAC
>probe:Drosophila_2:1634145_s_at:701:435; Interrogation_Position=529; Antisense; GAGGTTCACGCCTTCGTGTGCGACA
>probe:Drosophila_2:1634145_s_at:226:623; Interrogation_Position=558; Antisense; TGCGATGGCGCGGAAGTTGACCTTT
>probe:Drosophila_2:1634145_s_at:702:623; Interrogation_Position=599; Antisense; TCCAGGATTACTCGCGACGGGTCAA
>probe:Drosophila_2:1634145_s_at:207:439; Interrogation_Position=751; Antisense; GAGGCGTAGTTATCCTGGTGATCCT
>probe:Drosophila_2:1634145_s_at:561:623; Interrogation_Position=775; Antisense; TGCGTTGGCTCCGTCAATGAGATGT
>probe:Drosophila_2:1634145_s_at:300:475; Interrogation_Position=809; Antisense; GTTACTTAACGTCCAGTGTTCACTG
>probe:Drosophila_2:1634145_s_at:262:661; Interrogation_Position=840; Antisense; TAAATTGTGGTTCTCTCACCTGGTA
>probe:Drosophila_2:1634145_s_at:699:285; Interrogation_Position=859; Antisense; CTGGTAGTTGCCTCATACAGCTAAT
>probe:Drosophila_2:1634145_s_at:119:337; Interrogation_Position=878; Antisense; GCTAATTACCCAAAGCCTAAGTGTT

Paste this into a BLAST search page for me
GCATCAATCACTGGAGCTATCCCATATCGACACGATCTCGTATGGCGTTCTATGGCGTTCAGGACCTGGTCTACAACAAGGGTCTTTGCCATGATCGTGGGAGTCCGCATCCCTTTGAGGTTCACGAGGTTCACGCCTTCGTGTGCGACATGCGATGGCGCGGAAGTTGACCTTTTCCAGGATTACTCGCGACGGGTCAAGAGGCGTAGTTATCCTGGTGATCCTTGCGTTGGCTCCGTCAATGAGATGTGTTACTTAACGTCCAGTGTTCACTGTAAATTGTGGTTCTCTCACCTGGTACTGGTAGTTGCCTCATACAGCTAATGCTAATTACCCAAAGCCTAAGTGTT

Full Affymetrix probeset data:

Annotations for 1634145_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime