FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634148_at:

>probe:Drosophila_2:1634148_at:52:407; Interrogation_Position=337; Antisense; GACTGATGAACGATCGCCTGGTCGA
>probe:Drosophila_2:1634148_at:250:317; Interrogation_Position=352; Antisense; GCCTGGTCGAACTCACTATTCAAAT
>probe:Drosophila_2:1634148_at:591:91; Interrogation_Position=389; Antisense; AGTTATCAACAGCACTTTGACCGCC
>probe:Drosophila_2:1634148_at:110:725; Interrogation_Position=405; Antisense; TTGACCGCCTTGGAGTACATGGACA
>probe:Drosophila_2:1634148_at:105:23; Interrogation_Position=463; Antisense; ATATATCATCGGTGGCTGGACTGCA
>probe:Drosophila_2:1634148_at:460:353; Interrogation_Position=485; Antisense; GCAGCCCACAGCTATAATGGCCATT
>probe:Drosophila_2:1634148_at:18:105; Interrogation_Position=523; Antisense; AGACGGGAGTTACCACATTCACCAG
>probe:Drosophila_2:1634148_at:657:667; Interrogation_Position=564; Antisense; TACTTTTACGCCCACTCTGGTGTAG
>probe:Drosophila_2:1634148_at:320:463; Interrogation_Position=610; Antisense; GATTCACGGACACTGGGCTACTGGA
>probe:Drosophila_2:1634148_at:294:51; Interrogation_Position=675; Antisense; ATGCTGGCCATGTTCAACCGGGTGA
>probe:Drosophila_2:1634148_at:578:507; Interrogation_Position=721; Antisense; GTGCGAGGAACCTGGTCTCAGCAAT
>probe:Drosophila_2:1634148_at:87:229; Interrogation_Position=759; Antisense; AATGGAACTGTCCTCATGCTGGAGA
>probe:Drosophila_2:1634148_at:622:507; Interrogation_Position=866; Antisense; GTGCGCATCATATTGTAATCTCTTT
>probe:Drosophila_2:1634148_at:275:493; Interrogation_Position=880; Antisense; GTAATCTCTTTCAATTCCTTGGTGA

Paste this into a BLAST search page for me
GACTGATGAACGATCGCCTGGTCGAGCCTGGTCGAACTCACTATTCAAATAGTTATCAACAGCACTTTGACCGCCTTGACCGCCTTGGAGTACATGGACAATATATCATCGGTGGCTGGACTGCAGCAGCCCACAGCTATAATGGCCATTAGACGGGAGTTACCACATTCACCAGTACTTTTACGCCCACTCTGGTGTAGGATTCACGGACACTGGGCTACTGGAATGCTGGCCATGTTCAACCGGGTGAGTGCGAGGAACCTGGTCTCAGCAATAATGGAACTGTCCTCATGCTGGAGAGTGCGCATCATATTGTAATCTCTTTGTAATCTCTTTCAATTCCTTGGTGA

Full Affymetrix probeset data:

Annotations for 1634148_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720