FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634149_at:

>probe:Drosophila_2:1634149_at:104:175; Interrogation_Position=3196; Antisense; AAAGCCGCTACCGAGGTGAACACGA
>probe:Drosophila_2:1634149_at:193:137; Interrogation_Position=3217; Antisense; ACGAACTTCAGTGGGATCTTTAGCT
>probe:Drosophila_2:1634149_at:610:115; Interrogation_Position=3238; Antisense; AGCTCCCTTTTACCGGGTGCTGAAG
>probe:Drosophila_2:1634149_at:481:507; Interrogation_Position=3254; Antisense; GTGCTGAAGCGAAACTCAATCCCGT
>probe:Drosophila_2:1634149_at:405:27; Interrogation_Position=3281; Antisense; ATACCAATGGCTGTCTGACCGGTTT
>probe:Drosophila_2:1634149_at:391:219; Interrogation_Position=3314; Antisense; AAGTCGGCTTCAATGGCATATGGAA
>probe:Drosophila_2:1634149_at:711:87; Interrogation_Position=3343; Antisense; AGTCTCGGTGAACTTTCTGGTGGCC
>probe:Drosophila_2:1634149_at:87:289; Interrogation_Position=3419; Antisense; CGGCTCCCTTGTACATTTTGGATGA
>probe:Drosophila_2:1634149_at:34:703; Interrogation_Position=3434; Antisense; TTTTGGATGAGGTGGACGCTGCCCT
>probe:Drosophila_2:1634149_at:223:585; Interrogation_Position=3458; Antisense; TGGACATGTCACACACCCAAAACAT
>probe:Drosophila_2:1634149_at:493:193; Interrogation_Position=3511; Antisense; AACTCGCAGTTCTTGATTGTGTCTC
>probe:Drosophila_2:1634149_at:448:515; Interrogation_Position=3529; Antisense; GTGTCTCTCAAGGATGGTCTCTTCA
>probe:Drosophila_2:1634149_at:111:147; Interrogation_Position=3577; Antisense; ACTCTCTTCGAGGAGGGTGTGTCCA
>probe:Drosophila_2:1634149_at:711:559; Interrogation_Position=3652; Antisense; GGAACTCGTTTACTTTCTTATCACT

Paste this into a BLAST search page for me
AAAGCCGCTACCGAGGTGAACACGAACGAACTTCAGTGGGATCTTTAGCTAGCTCCCTTTTACCGGGTGCTGAAGGTGCTGAAGCGAAACTCAATCCCGTATACCAATGGCTGTCTGACCGGTTTAAGTCGGCTTCAATGGCATATGGAAAGTCTCGGTGAACTTTCTGGTGGCCCGGCTCCCTTGTACATTTTGGATGATTTTGGATGAGGTGGACGCTGCCCTTGGACATGTCACACACCCAAAACATAACTCGCAGTTCTTGATTGTGTCTCGTGTCTCTCAAGGATGGTCTCTTCAACTCTCTTCGAGGAGGGTGTGTCCAGGAACTCGTTTACTTTCTTATCACT

Full Affymetrix probeset data:

Annotations for 1634149_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720