FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634152_at:

>probe:Drosophila_2:1634152_at:392:469; Interrogation_Position=138; Antisense; GTTCGTCAAGCTCAATCCATAGCAC
>probe:Drosophila_2:1634152_at:540:251; Interrogation_Position=264; Antisense; CAAGGATCCCAAGAAGCAGGCTTTA
>probe:Drosophila_2:1634152_at:427:375; Interrogation_Position=276; Antisense; GAAGCAGGCTTTAGTCAACCAACGC
>probe:Drosophila_2:1634152_at:222:103; Interrogation_Position=404; Antisense; AGAGCTCCTTCGAGTATCTGAATAT
>probe:Drosophila_2:1634152_at:610:683; Interrogation_Position=418; Antisense; TATCTGAATATCTTCCTGGAGGGCC
>probe:Drosophila_2:1634152_at:224:535; Interrogation_Position=457; Antisense; GGTGACCACCTCACAGTGGCTGATA
>probe:Drosophila_2:1634152_at:657:153; Interrogation_Position=469; Antisense; ACAGTGGCTGATATTGCCATCCTCT
>probe:Drosophila_2:1634152_at:620:479; Interrogation_Position=499; Antisense; GTTTCCACTTTCGAAATCTTTGATT
>probe:Drosophila_2:1634152_at:132:601; Interrogation_Position=519; Antisense; TGATTTCGACCTCAACAAGTACCCG
>probe:Drosophila_2:1634152_at:268:161; Interrogation_Position=533; Antisense; ACAAGTACCCGAATGTGGCCAGGTG
>probe:Drosophila_2:1634152_at:274:313; Interrogation_Position=550; Antisense; GCCAGGTGGTATGCCAACGCCAAGA
>probe:Drosophila_2:1634152_at:575:77; Interrogation_Position=623; Antisense; AGGGAGTATTTGATGCCCGTCAGGC
>probe:Drosophila_2:1634152_at:5:71; Interrogation_Position=71; Antisense; AGGCTCTCGGCGTGAAGCTGAACAT
>probe:Drosophila_2:1634152_at:596:207; Interrogation_Position=97; Antisense; AAGCTACTGAACACCTTGGAGAAGG

Paste this into a BLAST search page for me
GTTCGTCAAGCTCAATCCATAGCACCAAGGATCCCAAGAAGCAGGCTTTAGAAGCAGGCTTTAGTCAACCAACGCAGAGCTCCTTCGAGTATCTGAATATTATCTGAATATCTTCCTGGAGGGCCGGTGACCACCTCACAGTGGCTGATAACAGTGGCTGATATTGCCATCCTCTGTTTCCACTTTCGAAATCTTTGATTTGATTTCGACCTCAACAAGTACCCGACAAGTACCCGAATGTGGCCAGGTGGCCAGGTGGTATGCCAACGCCAAGAAGGGAGTATTTGATGCCCGTCAGGCAGGCTCTCGGCGTGAAGCTGAACATAAGCTACTGAACACCTTGGAGAAGG

Full Affymetrix probeset data:

Annotations for 1634152_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720