Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634153_at:

>probe:Drosophila_2:1634153_at:463:607; Interrogation_Position=104; Antisense; TGAGGCTCTCAATTGTGGTGGCGCT
>probe:Drosophila_2:1634153_at:342:683; Interrogation_Position=137; Antisense; TTCTCGTCTGCGTGCCGGAAACGGA
>probe:Drosophila_2:1634153_at:454:107; Interrogation_Position=185; Antisense; AGAAAATCGTGATCCACGTGCCCAT
>probe:Drosophila_2:1634153_at:619:201; Interrogation_Position=19; Antisense; AACCGCAGTTTGGTGAGTGGCGACC
>probe:Drosophila_2:1634153_at:466:391; Interrogation_Position=223; Antisense; GAAACGCACATACACACCGTGGTGA
>probe:Drosophila_2:1634153_at:503:157; Interrogation_Position=266; Antisense; ACAAGCCACTCGTCCTAAAGGAGGA
>probe:Drosophila_2:1634153_at:242:373; Interrogation_Position=294; Antisense; GAAGGTGATCCACGAGGACCACCGA
>probe:Drosophila_2:1634153_at:93:463; Interrogation_Position=327; Antisense; GATTCACCAGACCAAGGAACACATT
>probe:Drosophila_2:1634153_at:570:127; Interrogation_Position=356; Antisense; ACCACGAGAAGCACGATCACCATGA
>probe:Drosophila_2:1634153_at:197:579; Interrogation_Position=36; Antisense; TGGCGACCGGGTATTGCAACTACAC
>probe:Drosophila_2:1634153_at:715:261; Interrogation_Position=452; Antisense; CAGCGCTGCCGGAACTCGAAGAGGA
>probe:Drosophila_2:1634153_at:138:523; Interrogation_Position=516; Antisense; GGGCGGACTGCGAGACGACTTCATT
>probe:Drosophila_2:1634153_at:6:79; Interrogation_Position=62; Antisense; AGGATTACACCCGATATCCGTGCTC
>probe:Drosophila_2:1634153_at:456:689; Interrogation_Position=91; Antisense; TATTCGCAGCTCCTGAGGCTCTCAA

Paste this into a BLAST search page for me
TGAGGCTCTCAATTGTGGTGGCGCTTTCTCGTCTGCGTGCCGGAAACGGAAGAAAATCGTGATCCACGTGCCCATAACCGCAGTTTGGTGAGTGGCGACCGAAACGCACATACACACCGTGGTGAACAAGCCACTCGTCCTAAAGGAGGAGAAGGTGATCCACGAGGACCACCGAGATTCACCAGACCAAGGAACACATTACCACGAGAAGCACGATCACCATGATGGCGACCGGGTATTGCAACTACACCAGCGCTGCCGGAACTCGAAGAGGAGGGCGGACTGCGAGACGACTTCATTAGGATTACACCCGATATCCGTGCTCTATTCGCAGCTCCTGAGGCTCTCAA

Full Affymetrix probeset data:

Annotations for 1634153_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime