Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634154_at:

>probe:Drosophila_2:1634154_at:631:549; Interrogation_Position=3508; Antisense; GGAGGTGTTTGCAACCAGCTTAACT
>probe:Drosophila_2:1634154_at:71:115; Interrogation_Position=3524; Antisense; AGCTTAACTCTGGACCCAACACTGA
>probe:Drosophila_2:1634154_at:171:641; Interrogation_Position=3532; Antisense; TCTGGACCCAACACTGAGATCATTG
>probe:Drosophila_2:1634154_at:465:607; Interrogation_Position=3585; Antisense; TGATGTGGATTTGAGCGTGTTGCTT
>probe:Drosophila_2:1634154_at:111:329; Interrogation_Position=3599; Antisense; GCGTGTTGCTTGTGGTTGATTTGCT
>probe:Drosophila_2:1634154_at:349:459; Interrogation_Position=3616; Antisense; GATTTGCTGAGTCACTTGATCACCA
>probe:Drosophila_2:1634154_at:412:495; Interrogation_Position=3626; Antisense; GTCACTTGATCACCAATGTGGCCAA
>probe:Drosophila_2:1634154_at:112:65; Interrogation_Position=3641; Antisense; ATGTGGCCAATGACTGCAGCGGCAA
>probe:Drosophila_2:1634154_at:610:617; Interrogation_Position=3655; Antisense; TGCAGCGGCAAGACCACGACAGTTG
>probe:Drosophila_2:1634154_at:158:593; Interrogation_Position=3723; Antisense; TGGGTCGCCAACTGATTCGCCAACG
>probe:Drosophila_2:1634154_at:643:193; Interrogation_Position=3994; Antisense; AACTGCTATCGCAGATACTGCCGCA
>probe:Drosophila_2:1634154_at:141:305; Interrogation_Position=4029; Antisense; CCGTCCCAGCTACTTGTGCTACAAG
>probe:Drosophila_2:1634154_at:612:339; Interrogation_Position=4046; Antisense; GCTACAAGAACTGCGGTGGTGCCTT
>probe:Drosophila_2:1634154_at:210:587; Interrogation_Position=4062; Antisense; TGGTGCCTTCGTCTACAAGCCCTAA

Paste this into a BLAST search page for me
GGAGGTGTTTGCAACCAGCTTAACTAGCTTAACTCTGGACCCAACACTGATCTGGACCCAACACTGAGATCATTGTGATGTGGATTTGAGCGTGTTGCTTGCGTGTTGCTTGTGGTTGATTTGCTGATTTGCTGAGTCACTTGATCACCAGTCACTTGATCACCAATGTGGCCAAATGTGGCCAATGACTGCAGCGGCAATGCAGCGGCAAGACCACGACAGTTGTGGGTCGCCAACTGATTCGCCAACGAACTGCTATCGCAGATACTGCCGCACCGTCCCAGCTACTTGTGCTACAAGGCTACAAGAACTGCGGTGGTGCCTTTGGTGCCTTCGTCTACAAGCCCTAA

Full Affymetrix probeset data:

Annotations for 1634154_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime