FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634155_at:

>probe:Drosophila_2:1634155_at:168:665; Interrogation_Position=317; Antisense; TAGAATAGCCCATACACCAGGTTCC
>probe:Drosophila_2:1634155_at:139:305; Interrogation_Position=348; Antisense; CCTGACTTCTTTTCCGACAAGCATA
>probe:Drosophila_2:1634155_at:299:713; Interrogation_Position=378; Antisense; TTGGAGTCCTTTGTGCGGCTTTTCA
>probe:Drosophila_2:1634155_at:226:341; Interrogation_Position=395; Antisense; GCTTTTCACCGTATACTTCACCAAA
>probe:Drosophila_2:1634155_at:236:363; Interrogation_Position=438; Antisense; GAATTCGCATTCTCGGTCTACGATA
>probe:Drosophila_2:1634155_at:665:105; Interrogation_Position=490; Antisense; AGCAAGTTGGGTTCTTCGTCGGCAA
>probe:Drosophila_2:1634155_at:239:105; Interrogation_Position=536; Antisense; AGACGAATCCATTGAGCTGCGCTTG
>probe:Drosophila_2:1634155_at:274:447; Interrogation_Position=572; Antisense; GATGCTGTTCCTCAAATTCGACTTG
>probe:Drosophila_2:1634155_at:180:607; Interrogation_Position=623; Antisense; TGAGTACTACGAGGTGGTCCGCCGA
>probe:Drosophila_2:1634155_at:651:367; Interrogation_Position=689; Antisense; GAATCCCCAGATGGAGGTCCTTGCG
>probe:Drosophila_2:1634155_at:288:625; Interrogation_Position=710; Antisense; TGCGCTGTGCGCCAATGTAATGTCT
>probe:Drosophila_2:1634155_at:583:59; Interrogation_Position=729; Antisense; ATGTCTTGGTTTGACGATTCGCCCA
>probe:Drosophila_2:1634155_at:648:311; Interrogation_Position=789; Antisense; GCCAGCTAGCTAACAGGACGTCCAG
>probe:Drosophila_2:1634155_at:416:505; Interrogation_Position=808; Antisense; GTCCAGGAACGCATTTTTATCTAAC

Paste this into a BLAST search page for me
TAGAATAGCCCATACACCAGGTTCCCCTGACTTCTTTTCCGACAAGCATATTGGAGTCCTTTGTGCGGCTTTTCAGCTTTTCACCGTATACTTCACCAAAGAATTCGCATTCTCGGTCTACGATAAGCAAGTTGGGTTCTTCGTCGGCAAAGACGAATCCATTGAGCTGCGCTTGGATGCTGTTCCTCAAATTCGACTTGTGAGTACTACGAGGTGGTCCGCCGAGAATCCCCAGATGGAGGTCCTTGCGTGCGCTGTGCGCCAATGTAATGTCTATGTCTTGGTTTGACGATTCGCCCAGCCAGCTAGCTAACAGGACGTCCAGGTCCAGGAACGCATTTTTATCTAAC

Full Affymetrix probeset data:

Annotations for 1634155_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720