FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634156_at:

>probe:Drosophila_2:1634156_at:320:451; Interrogation_Position=7764; Antisense; GATCGTCAGTGAACGTCACCATCGA
>probe:Drosophila_2:1634156_at:89:203; Interrogation_Position=7790; Antisense; AACCTGGAAGCGTACTGCGAACTGC
>probe:Drosophila_2:1634156_at:18:369; Interrogation_Position=7839; Antisense; GAATCGCTCAGCAAATGAAGGCCTT
>probe:Drosophila_2:1634156_at:459:361; Interrogation_Position=7855; Antisense; GAAGGCCTTCAGTGATGGGTTCAAT
>probe:Drosophila_2:1634156_at:182:593; Interrogation_Position=7870; Antisense; TGGGTTCAATGAAGTGTTCCCTTTG
>probe:Drosophila_2:1634156_at:627:211; Interrogation_Position=8013; Antisense; AAGACAGTCCCGGATTCCAACGCTT
>probe:Drosophila_2:1634156_at:478:65; Interrogation_Position=8072; Antisense; AGGAAGGCGTTCCTCCAATTCACAA
>probe:Drosophila_2:1634156_at:528:245; Interrogation_Position=8088; Antisense; AATTCACAACCGGTTGCAGCAGCCT
>probe:Drosophila_2:1634156_at:490:43; Interrogation_Position=8139; Antisense; ATCCCCGACTGACAGTTGTCCGAAA
>probe:Drosophila_2:1634156_at:283:99; Interrogation_Position=8167; Antisense; AGATGCTGGCGTTGGAAGCTATCCA
>probe:Drosophila_2:1634156_at:528:377; Interrogation_Position=8181; Antisense; GAAGCTATCCATCCGTGAACACGTG
>probe:Drosophila_2:1634156_at:22:141; Interrogation_Position=8201; Antisense; ACGTGCGTTCACTACTTAAAGCTTC
>probe:Drosophila_2:1634156_at:108:405; Interrogation_Position=8228; Antisense; GACTACCCAACCGAAGAGATCATGA
>probe:Drosophila_2:1634156_at:698:369; Interrogation_Position=8251; Antisense; GAAGGAGCGCTTGTTAACAGCAACC

Paste this into a BLAST search page for me
GATCGTCAGTGAACGTCACCATCGAAACCTGGAAGCGTACTGCGAACTGCGAATCGCTCAGCAAATGAAGGCCTTGAAGGCCTTCAGTGATGGGTTCAATTGGGTTCAATGAAGTGTTCCCTTTGAAGACAGTCCCGGATTCCAACGCTTAGGAAGGCGTTCCTCCAATTCACAAAATTCACAACCGGTTGCAGCAGCCTATCCCCGACTGACAGTTGTCCGAAAAGATGCTGGCGTTGGAAGCTATCCAGAAGCTATCCATCCGTGAACACGTGACGTGCGTTCACTACTTAAAGCTTCGACTACCCAACCGAAGAGATCATGAGAAGGAGCGCTTGTTAACAGCAACC

Full Affymetrix probeset data:

Annotations for 1634156_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720