FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634157_at:

>probe:Drosophila_2:1634157_at:348:609; Interrogation_Position=1443; Antisense; TGAGCACTGCGAGCCAACAGGAGAT
>probe:Drosophila_2:1634157_at:166:153; Interrogation_Position=1527; Antisense; ACAGGGAGTTCTTCCTAAGCTTCGC
>probe:Drosophila_2:1634157_at:345:659; Interrogation_Position=1542; Antisense; TAAGCTTCGCCAAGGATCCACAAAT
>probe:Drosophila_2:1634157_at:649:411; Interrogation_Position=1615; Antisense; GACCGATGTAGCTGGCAATCCGGAG
>probe:Drosophila_2:1634157_at:31:71; Interrogation_Position=1644; Antisense; AGCGTCGGGCGGAGTTCTATTACCA
>probe:Drosophila_2:1634157_at:509:689; Interrogation_Position=1661; Antisense; TATTACCAGCCATGGACGCACGAGG
>probe:Drosophila_2:1634157_at:594:221; Interrogation_Position=1709; Antisense; AAGGTCAACCAGAAGCGGGCCGAAT
>probe:Drosophila_2:1634157_at:36:287; Interrogation_Position=1745; Antisense; CTGGGCATACGCAACGGCTAGGTGA
>probe:Drosophila_2:1634157_at:173:59; Interrogation_Position=1770; Antisense; ATGATGAGCTGATCATCTCCACCAG
>probe:Drosophila_2:1634157_at:503:651; Interrogation_Position=1815; Antisense; TCAAGAGACCTCCATAAACCGTGCG
>probe:Drosophila_2:1634157_at:610:707; Interrogation_Position=1855; Antisense; TTCCTTCGCCAGTTTAGTTTAAGCT
>probe:Drosophila_2:1634157_at:616:699; Interrogation_Position=1893; Antisense; TTTTTTCCGACAAGCCGAACTCCAT
>probe:Drosophila_2:1634157_at:200:725; Interrogation_Position=1942; Antisense; TTGCAGTTGTCCCAAATACCCACAT
>probe:Drosophila_2:1634157_at:76:29; Interrogation_Position=1957; Antisense; ATACCCACATCCAGCACAAATATTG

Paste this into a BLAST search page for me
TGAGCACTGCGAGCCAACAGGAGATACAGGGAGTTCTTCCTAAGCTTCGCTAAGCTTCGCCAAGGATCCACAAATGACCGATGTAGCTGGCAATCCGGAGAGCGTCGGGCGGAGTTCTATTACCATATTACCAGCCATGGACGCACGAGGAAGGTCAACCAGAAGCGGGCCGAATCTGGGCATACGCAACGGCTAGGTGAATGATGAGCTGATCATCTCCACCAGTCAAGAGACCTCCATAAACCGTGCGTTCCTTCGCCAGTTTAGTTTAAGCTTTTTTTCCGACAAGCCGAACTCCATTTGCAGTTGTCCCAAATACCCACATATACCCACATCCAGCACAAATATTG

Full Affymetrix probeset data:

Annotations for 1634157_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720