FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634158_at:

>probe:Drosophila_2:1634158_at:147:89; Interrogation_Position=158; Antisense; AGTCGATTAAACCATGCGCGGCGCC
>probe:Drosophila_2:1634158_at:521:287; Interrogation_Position=176; Antisense; CGGCGCCCTAATGGATTACTATCTA
>probe:Drosophila_2:1634158_at:429:241; Interrogation_Position=203; Antisense; AATACTCTTGGTTATTTGCGCTGCC
>probe:Drosophila_2:1634158_at:349:727; Interrogation_Position=234; Antisense; TTGGCCGGCGGAACGATCAAGTCTA
>probe:Drosophila_2:1634158_at:549:215; Interrogation_Position=293; Antisense; AAGATCTTTGCCCTTCGAGGATTGC
>probe:Drosophila_2:1634158_at:493:463; Interrogation_Position=312; Antisense; GATTGCGGTTCTTTGTACCAGGTCA
>probe:Drosophila_2:1634158_at:581:43; Interrogation_Position=348; Antisense; ATCGAGAGCTGTACGACACTGCCCT
>probe:Drosophila_2:1634158_at:361:269; Interrogation_Position=377; Antisense; CATGGCCCGGAACGCGACAATTAAG
>probe:Drosophila_2:1634158_at:729:227; Interrogation_Position=423; Antisense; AATGGCAATGGCGTCAGCTTTCTGA
>probe:Drosophila_2:1634158_at:708:115; Interrogation_Position=438; Antisense; AGCTTTCTGAAGCACGAAGTCCGAT
>probe:Drosophila_2:1634158_at:586:371; Interrogation_Position=453; Antisense; GAAGTCCGATGGGTGTTTAACTACA
>probe:Drosophila_2:1634158_at:149:709; Interrogation_Position=469; Antisense; TTAACTACATCAAGACCCAGGCGGC
>probe:Drosophila_2:1634158_at:134:601; Interrogation_Position=571; Antisense; TCTTTGTGAACGAAACTTTGCCGGT
>probe:Drosophila_2:1634158_at:121:629; Interrogation_Position=655; Antisense; TCCAGGTTCCCGTTGTAATCACAGT

Paste this into a BLAST search page for me
AGTCGATTAAACCATGCGCGGCGCCCGGCGCCCTAATGGATTACTATCTAAATACTCTTGGTTATTTGCGCTGCCTTGGCCGGCGGAACGATCAAGTCTAAAGATCTTTGCCCTTCGAGGATTGCGATTGCGGTTCTTTGTACCAGGTCAATCGAGAGCTGTACGACACTGCCCTCATGGCCCGGAACGCGACAATTAAGAATGGCAATGGCGTCAGCTTTCTGAAGCTTTCTGAAGCACGAAGTCCGATGAAGTCCGATGGGTGTTTAACTACATTAACTACATCAAGACCCAGGCGGCTCTTTGTGAACGAAACTTTGCCGGTTCCAGGTTCCCGTTGTAATCACAGT

Full Affymetrix probeset data:

Annotations for 1634158_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720