Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634159_s_at:

>probe:Drosophila_2:1634159_s_at:485:629; Interrogation_Position=104; Antisense; TCCAGGATCTGGACGAGAACCATTT
>probe:Drosophila_2:1634159_s_at:667:379; Interrogation_Position=120; Antisense; GAACCATTTGTTTATCTCCACGGAC
>probe:Drosophila_2:1634159_s_at:227:689; Interrogation_Position=126; Antisense; TTTGTTTATCTCCACGGACATTGTG
>probe:Drosophila_2:1634159_s_at:140:403; Interrogation_Position=142; Antisense; GACATTGTGGAAGTTTTGCAGGCGC
>probe:Drosophila_2:1634159_s_at:21:703; Interrogation_Position=155; Antisense; TTTTGCAGGCGCGAGTGGACGACTT
>probe:Drosophila_2:1634159_s_at:347:83; Interrogation_Position=168; Antisense; AGTGGACGACTTGATGGATCGGATA
>probe:Drosophila_2:1634159_s_at:696:545; Interrogation_Position=183; Antisense; GGATCGGATAAGCTTTCCGCTGCAC
>probe:Drosophila_2:1634159_s_at:29:633; Interrogation_Position=198; Antisense; TCCGCTGCACGACAAGGACGCTTAG
>probe:Drosophila_2:1634159_s_at:332:621; Interrogation_Position=23; Antisense; TGCTGGTGGAGTGTGATCCTGCTAT
>probe:Drosophila_2:1634159_s_at:320:513; Interrogation_Position=35; Antisense; GTGATCCTGCTATGAAACAATTCCT
>probe:Drosophila_2:1634159_s_at:445:389; Interrogation_Position=48; Antisense; GAAACAATTCCTGCTGCACTTGGAC
>probe:Drosophila_2:1634159_s_at:70:353; Interrogation_Position=63; Antisense; GCACTTGGACGAAAAACTGGCTCTG
>probe:Drosophila_2:1634159_s_at:449:195; Interrogation_Position=77; Antisense; AACTGGCTCTGGGACGCAAATTCAT
>probe:Drosophila_2:1634159_s_at:380:409; Interrogation_Position=89; Antisense; GACGCAAATTCATTATCCAGGATCT

Paste this into a BLAST search page for me
TCCAGGATCTGGACGAGAACCATTTGAACCATTTGTTTATCTCCACGGACTTTGTTTATCTCCACGGACATTGTGGACATTGTGGAAGTTTTGCAGGCGCTTTTGCAGGCGCGAGTGGACGACTTAGTGGACGACTTGATGGATCGGATAGGATCGGATAAGCTTTCCGCTGCACTCCGCTGCACGACAAGGACGCTTAGTGCTGGTGGAGTGTGATCCTGCTATGTGATCCTGCTATGAAACAATTCCTGAAACAATTCCTGCTGCACTTGGACGCACTTGGACGAAAAACTGGCTCTGAACTGGCTCTGGGACGCAAATTCATGACGCAAATTCATTATCCAGGATCT

Full Affymetrix probeset data:

Annotations for 1634159_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime