FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634161_at:

>probe:Drosophila_2:1634161_at:431:163; Interrogation_Position=560; Antisense; AAATTCTGCATAATCGACGGCTTCG
>probe:Drosophila_2:1634161_at:106:637; Interrogation_Position=582; Antisense; TCGAGCGCGTCGAGGAGATTCGTCT
>probe:Drosophila_2:1634161_at:709:95; Interrogation_Position=597; Antisense; AGATTCGTCTGCTGAGGAAGCTCAA
>probe:Drosophila_2:1634161_at:455:377; Interrogation_Position=613; Antisense; GAAGCTCAAGTTTATGCGTCCGTGC
>probe:Drosophila_2:1634161_at:516:51; Interrogation_Position=626; Antisense; ATGCGTCCGTGCTATAGCATCGTGA
>probe:Drosophila_2:1634161_at:449:513; Interrogation_Position=647; Antisense; GTGATCAGCGGCTCCGTAAACTGGA
>probe:Drosophila_2:1634161_at:610:177; Interrogation_Position=664; Antisense; AAACTGGACGGCTCTTGGACTGGGA
>probe:Drosophila_2:1634161_at:63:385; Interrogation_Position=700; Antisense; GAACTGCATTATCACAGCTGACGAC
>probe:Drosophila_2:1634161_at:54:611; Interrogation_Position=718; Antisense; TGACGACAAACTCACAGCCACGTTT
>probe:Drosophila_2:1634161_at:436:115; Interrogation_Position=733; Antisense; AGCCACGTTTCAGGCGGAATTCCAA
>probe:Drosophila_2:1634161_at:701:229; Interrogation_Position=760; Antisense; AATGTGGCGGGCTTTTGCGAAGACC
>probe:Drosophila_2:1634161_at:633:127; Interrogation_Position=837; Antisense; ACCAAACAGTTCCTCAGTATGCCAA
>probe:Drosophila_2:1634161_at:647:471; Interrogation_Position=871; Antisense; GTTCTTATTTTCTAAGTGCCTTCAA
>probe:Drosophila_2:1634161_at:22:227; Interrogation_Position=913; Antisense; AAGGCAGCTTGATCTTCACACACAA

Paste this into a BLAST search page for me
AAATTCTGCATAATCGACGGCTTCGTCGAGCGCGTCGAGGAGATTCGTCTAGATTCGTCTGCTGAGGAAGCTCAAGAAGCTCAAGTTTATGCGTCCGTGCATGCGTCCGTGCTATAGCATCGTGAGTGATCAGCGGCTCCGTAAACTGGAAAACTGGACGGCTCTTGGACTGGGAGAACTGCATTATCACAGCTGACGACTGACGACAAACTCACAGCCACGTTTAGCCACGTTTCAGGCGGAATTCCAAAATGTGGCGGGCTTTTGCGAAGACCACCAAACAGTTCCTCAGTATGCCAAGTTCTTATTTTCTAAGTGCCTTCAAAAGGCAGCTTGATCTTCACACACAA

Full Affymetrix probeset data:

Annotations for 1634161_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720