FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634162_at:

>probe:Drosophila_2:1634162_at:724:305; Interrogation_Position=108; Antisense; TCCTTATTAAGGTTTTCGCTCCCAG
>probe:Drosophila_2:1634162_at:581:161; Interrogation_Position=160; Antisense; AAATACAGTGGGAGCATCGCCTTTC
>probe:Drosophila_2:1634162_at:53:277; Interrogation_Position=194; Antisense; CTTATCTCTGGTCTTATCTCATCAA
>probe:Drosophila_2:1634162_at:104:385; Interrogation_Position=232; Antisense; GAACAGCGTGCTACAGACCAAGTCT
>probe:Drosophila_2:1634162_at:340:219; Interrogation_Position=287; Antisense; AAGTCTGTCAATTTATTTGGCCCCA
>probe:Drosophila_2:1634162_at:87:421; Interrogation_Position=322; Antisense; GAGCACCACCGAAAGGCCTGTGACA
>probe:Drosophila_2:1634162_at:317:595; Interrogation_Position=340; Antisense; TGTGACACACCATACCACCGAGGTA
>probe:Drosophila_2:1634162_at:360:179; Interrogation_Position=364; Antisense; AAACACAGACTTTACTCCGGATGAA
>probe:Drosophila_2:1634162_at:295:679; Interrogation_Position=394; Antisense; TAGGACTACTCAACTTTTTTACTCG
>probe:Drosophila_2:1634162_at:348:147; Interrogation_Position=479; Antisense; ACTACCACTTCAGTGATCCCAATAG
>probe:Drosophila_2:1634162_at:554:241; Interrogation_Position=499; Antisense; AATAGAGAGCACCACATCCGTAACA
>probe:Drosophila_2:1634162_at:565:255; Interrogation_Position=546; Antisense; CAAAACCTGGATACTCCTATCGCAC
>probe:Drosophila_2:1634162_at:544:725; Interrogation_Position=612; Antisense; TTGTCAACTCAAATAACGCAGCCCC
>probe:Drosophila_2:1634162_at:188:263; Interrogation_Position=630; Antisense; CAGCCCCAGCAATGTTCGCAAATGA

Paste this into a BLAST search page for me
TCCTTATTAAGGTTTTCGCTCCCAGAAATACAGTGGGAGCATCGCCTTTCCTTATCTCTGGTCTTATCTCATCAAGAACAGCGTGCTACAGACCAAGTCTAAGTCTGTCAATTTATTTGGCCCCAGAGCACCACCGAAAGGCCTGTGACATGTGACACACCATACCACCGAGGTAAAACACAGACTTTACTCCGGATGAATAGGACTACTCAACTTTTTTACTCGACTACCACTTCAGTGATCCCAATAGAATAGAGAGCACCACATCCGTAACACAAAACCTGGATACTCCTATCGCACTTGTCAACTCAAATAACGCAGCCCCCAGCCCCAGCAATGTTCGCAAATGA

Full Affymetrix probeset data:

Annotations for 1634162_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720