Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634163_at:

>probe:Drosophila_2:1634163_at:343:361; Interrogation_Position=15670; Antisense; GCAAGCACTACAGCCACAGCGAGTT
>probe:Drosophila_2:1634163_at:400:469; Interrogation_Position=15692; Antisense; GTTCCACTGGAGCTCTGCCCAAGGA
>probe:Drosophila_2:1634163_at:245:113; Interrogation_Position=15759; Antisense; AGCACCACTGCCTGTAGAGGGCGGT
>probe:Drosophila_2:1634163_at:53:101; Interrogation_Position=15774; Antisense; AGAGGGCGGTGCTGACATTCGCACC
>probe:Drosophila_2:1634163_at:257:11; Interrogation_Position=15790; Antisense; ATTCGCACCACTCCCAAGAAGGAAC
>probe:Drosophila_2:1634163_at:291:593; Interrogation_Position=15821; Antisense; TGGTGGCCACCAAGACGCGACTGAA
>probe:Drosophila_2:1634163_at:205:359; Interrogation_Position=15874; Antisense; GAATCACCCAACAAGGCCGGCAAGA
>probe:Drosophila_2:1634163_at:146:499; Interrogation_Position=15910; Antisense; GTCTACGTGGACCTCACATACGTGC
>probe:Drosophila_2:1634163_at:47:1; Interrogation_Position=15927; Antisense; ATACGTGCCGCACAACGGAAACTCC
>probe:Drosophila_2:1634163_at:35:673; Interrogation_Position=15955; Antisense; TACGCCCACGTGGACTTCTTTAAGC
>probe:Drosophila_2:1634163_at:403:381; Interrogation_Position=16015; Antisense; GAACCCAGTCGCCAGGTGTATGATG
>probe:Drosophila_2:1634163_at:690:483; Interrogation_Position=16032; Antisense; GTATGATGCGCTGCTCGAGGCCAAA
>probe:Drosophila_2:1634163_at:474:537; Interrogation_Position=16083; Antisense; GGTCACCATTATACCTACGTACGAC
>probe:Drosophila_2:1634163_at:646:275; Interrogation_Position=16100; Antisense; CGTACGACACAGATGTTCTAGGTTA

Paste this into a BLAST search page for me
GCAAGCACTACAGCCACAGCGAGTTGTTCCACTGGAGCTCTGCCCAAGGAAGCACCACTGCCTGTAGAGGGCGGTAGAGGGCGGTGCTGACATTCGCACCATTCGCACCACTCCCAAGAAGGAACTGGTGGCCACCAAGACGCGACTGAAGAATCACCCAACAAGGCCGGCAAGAGTCTACGTGGACCTCACATACGTGCATACGTGCCGCACAACGGAAACTCCTACGCCCACGTGGACTTCTTTAAGCGAACCCAGTCGCCAGGTGTATGATGGTATGATGCGCTGCTCGAGGCCAAAGGTCACCATTATACCTACGTACGACCGTACGACACAGATGTTCTAGGTTA

Full Affymetrix probeset data:

Annotations for 1634163_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime