FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634165_at:

>probe:Drosophila_2:1634165_at:346:691; Interrogation_Position=1013; Antisense; TTTGGGCGCCACAATACTCCTGATA
>probe:Drosophila_2:1634165_at:397:145; Interrogation_Position=1028; Antisense; ACTCCTGATACTCCCCTGAATGAAA
>probe:Drosophila_2:1634165_at:615:199; Interrogation_Position=1090; Antisense; AACGCCTGTGTATTGCGGACATTTT
>probe:Drosophila_2:1634165_at:714:533; Interrogation_Position=1150; Antisense; GGTGCCGTAGTATTTAATGTCTCCT
>probe:Drosophila_2:1634165_at:58:523; Interrogation_Position=619; Antisense; GTGGCGGCGATCAGATTGCCCTCTT
>probe:Drosophila_2:1634165_at:372:711; Interrogation_Position=642; Antisense; TTCATTGCCGAGCAGGGACCCGAGT
>probe:Drosophila_2:1634165_at:564:561; Interrogation_Position=683; Antisense; GGAAGCCATTAGCAATTGCCTCAAT
>probe:Drosophila_2:1634165_at:426:235; Interrogation_Position=709; Antisense; AATCCTTTCATCAGTACATTCCCAA
>probe:Drosophila_2:1634165_at:620:439; Interrogation_Position=735; Antisense; GATGGCCAAGTTCCGGACCTGATGA
>probe:Drosophila_2:1634165_at:98:71; Interrogation_Position=814; Antisense; AGGCCTGTGTCATCCATCATTTGGA
>probe:Drosophila_2:1634165_at:205:97; Interrogation_Position=850; Antisense; AGATCACCACCGCTAATATCGTTCA
>probe:Drosophila_2:1634165_at:557:241; Interrogation_Position=864; Antisense; AATATCGTTCAGTCCGTCTTCCGTT
>probe:Drosophila_2:1634165_at:395:107; Interrogation_Position=895; Antisense; AGAACGAGACCGACTGCCAGGCTTG
>probe:Drosophila_2:1634165_at:377:507; Interrogation_Position=931; Antisense; GTGCGAACGAGAAGCCCATTCTGAT

Paste this into a BLAST search page for me
TTTGGGCGCCACAATACTCCTGATAACTCCTGATACTCCCCTGAATGAAAAACGCCTGTGTATTGCGGACATTTTGGTGCCGTAGTATTTAATGTCTCCTGTGGCGGCGATCAGATTGCCCTCTTTTCATTGCCGAGCAGGGACCCGAGTGGAAGCCATTAGCAATTGCCTCAATAATCCTTTCATCAGTACATTCCCAAGATGGCCAAGTTCCGGACCTGATGAAGGCCTGTGTCATCCATCATTTGGAAGATCACCACCGCTAATATCGTTCAAATATCGTTCAGTCCGTCTTCCGTTAGAACGAGACCGACTGCCAGGCTTGGTGCGAACGAGAAGCCCATTCTGAT

Full Affymetrix probeset data:

Annotations for 1634165_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720