Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634167_a_at:

>probe:Drosophila_2:1634167_a_at:179:283; Interrogation_Position=434; Antisense; CTCCGCCCATGTATATGAGCTATAG
>probe:Drosophila_2:1634167_a_at:76:687; Interrogation_Position=454; Antisense; TATAGCGGCGGTAGTATAGCCAATA
>probe:Drosophila_2:1634167_a_at:703:171; Interrogation_Position=499; Antisense; AAAGAGCACAATCCCGCCTGGCGGG
>probe:Drosophila_2:1634167_a_at:75:109; Interrogation_Position=542; Antisense; AGAAGGACTATAGACGCACCGCCTG
>probe:Drosophila_2:1634167_a_at:476:353; Interrogation_Position=557; Antisense; GCACCGCCTGCGATCGGGAAAGAAC
>probe:Drosophila_2:1634167_a_at:447:551; Interrogation_Position=591; Antisense; GGACATGAACCGAGCCTTTGACTTA
>probe:Drosophila_2:1634167_a_at:629:275; Interrogation_Position=606; Antisense; CTTTGACTTACTGCGCTCCAAGCTA
>probe:Drosophila_2:1634167_a_at:584:205; Interrogation_Position=625; Antisense; AAGCTACCCATATCCAAGCCAAATG
>probe:Drosophila_2:1634167_a_at:54:437; Interrogation_Position=678; Antisense; GAGGATTGCCATCAACTACATTAAT
>probe:Drosophila_2:1634167_a_at:391:147; Interrogation_Position=692; Antisense; ACTACATTAATCACCTGCAGGCCAT
>probe:Drosophila_2:1634167_a_at:351:419; Interrogation_Position=726; Antisense; GAGCTCCGTGGGTCAAAATGGCAAT
>probe:Drosophila_2:1634167_a_at:406:573; Interrogation_Position=769; Antisense; GGCGGAAGTAGTTCACCTTATGATA
>probe:Drosophila_2:1634167_a_at:274:363; Interrogation_Position=889; Antisense; GCAATTTGCCAAAGTCATTCCATGA
>probe:Drosophila_2:1634167_a_at:662:77; Interrogation_Position=928; Antisense; AGGTCCATACTTTACGATTTTGAGA

Paste this into a BLAST search page for me
CTCCGCCCATGTATATGAGCTATAGTATAGCGGCGGTAGTATAGCCAATAAAAGAGCACAATCCCGCCTGGCGGGAGAAGGACTATAGACGCACCGCCTGGCACCGCCTGCGATCGGGAAAGAACGGACATGAACCGAGCCTTTGACTTACTTTGACTTACTGCGCTCCAAGCTAAAGCTACCCATATCCAAGCCAAATGGAGGATTGCCATCAACTACATTAATACTACATTAATCACCTGCAGGCCATGAGCTCCGTGGGTCAAAATGGCAATGGCGGAAGTAGTTCACCTTATGATAGCAATTTGCCAAAGTCATTCCATGAAGGTCCATACTTTACGATTTTGAGA

Full Affymetrix probeset data:

Annotations for 1634167_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime