Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634168_s_at:

>probe:Drosophila_2:1634168_s_at:472:411; Interrogation_Position=1010; Antisense; GACGCTGTTCCAGGATATTGGCGAA
>probe:Drosophila_2:1634168_s_at:412:409; Interrogation_Position=1083; Antisense; GACGACGACGATTAAGCTACAAACT
>probe:Drosophila_2:1634168_s_at:220:195; Interrogation_Position=1104; Antisense; AACTGTGTCAAACTACTCAAAGGCA
>probe:Drosophila_2:1634168_s_at:285:153; Interrogation_Position=607; Antisense; ACATGTTTGAAACGCGCCTCCTGGA
>probe:Drosophila_2:1634168_s_at:490:315; Interrogation_Position=622; Antisense; GCCTCCTGGAACACCTGCAAAAGAC
>probe:Drosophila_2:1634168_s_at:197:427; Interrogation_Position=669; Antisense; GAGATGATCTTTTCGCTGGTAAGCA
>probe:Drosophila_2:1634168_s_at:199:209; Interrogation_Position=689; Antisense; AAGCAGCGCCCAGGAGTGGCTGAAC
>probe:Drosophila_2:1634168_s_at:298:357; Interrogation_Position=790; Antisense; GCAAGAAGTTTGAGGGCACCCGTGT
>probe:Drosophila_2:1634168_s_at:600:285; Interrogation_Position=810; Antisense; CGTGTGACGGTGGAGTCCTTCCTCA
>probe:Drosophila_2:1634168_s_at:426:9; Interrogation_Position=848; Antisense; ATTCGAGGAGAGCACCGGCATTGCC
>probe:Drosophila_2:1634168_s_at:645:375; Interrogation_Position=902; Antisense; GAAGCAGACCGGACGCGAACTCTTT
>probe:Drosophila_2:1634168_s_at:203:325; Interrogation_Position=916; Antisense; GCGAACTCTTTATGTGCGACAACAC
>probe:Drosophila_2:1634168_s_at:694:397; Interrogation_Position=933; Antisense; GACAACACGCTCAACGATTCGGATA
>probe:Drosophila_2:1634168_s_at:371:543; Interrogation_Position=953; Antisense; GGATATCAAGTTCCTCCTGGAGGCG

Paste this into a BLAST search page for me
GACGCTGTTCCAGGATATTGGCGAAGACGACGACGATTAAGCTACAAACTAACTGTGTCAAACTACTCAAAGGCAACATGTTTGAAACGCGCCTCCTGGAGCCTCCTGGAACACCTGCAAAAGACGAGATGATCTTTTCGCTGGTAAGCAAAGCAGCGCCCAGGAGTGGCTGAACGCAAGAAGTTTGAGGGCACCCGTGTCGTGTGACGGTGGAGTCCTTCCTCAATTCGAGGAGAGCACCGGCATTGCCGAAGCAGACCGGACGCGAACTCTTTGCGAACTCTTTATGTGCGACAACACGACAACACGCTCAACGATTCGGATAGGATATCAAGTTCCTCCTGGAGGCG

Full Affymetrix probeset data:

Annotations for 1634168_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime