FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634171_at:

>probe:Drosophila_2:1634171_at:139:359; Interrogation_Position=128; Antisense; GCAACAACTACACTTTTCCGCTGGG
>probe:Drosophila_2:1634171_at:630:59; Interrogation_Position=13; Antisense; ATGTTCCTGAATGCCCTGCGAAGGA
>probe:Drosophila_2:1634171_at:586:295; Interrogation_Position=190; Antisense; CGAGAGTACGCATTTTTGGCGCTCA
>probe:Drosophila_2:1634171_at:205:629; Interrogation_Position=220; Antisense; TCCATTTCCGGCATCTTTGAGATTC
>probe:Drosophila_2:1634171_at:416:605; Interrogation_Position=237; Antisense; TGAGATTCATCCCTGCAATGGGCAG
>probe:Drosophila_2:1634171_at:409:437; Interrogation_Position=262; Antisense; GAGGAGTTGGGCGAACACTTCCGTT
>probe:Drosophila_2:1634171_at:122:631; Interrogation_Position=281; Antisense; TCCGTTTCCGGAAGAGCATTCTGCT
>probe:Drosophila_2:1634171_at:550:131; Interrogation_Position=313; Antisense; ACCGACTTTACCTGCGCTGAAGTGA
>probe:Drosophila_2:1634171_at:525:613; Interrogation_Position=335; Antisense; TGAAGCGCGTTATCAACCTGCTGGG
>probe:Drosophila_2:1634171_at:313:495; Interrogation_Position=436; Antisense; GTCTGTGGCCGTAAAATTCCGCGTT
>probe:Drosophila_2:1634171_at:264:271; Interrogation_Position=483; Antisense; CATAACGTGTGTCCCATTCCTCGAA
>probe:Drosophila_2:1634171_at:158:381; Interrogation_Position=505; Antisense; GAACGCTTTGTGGTCTCCAGTCCAT
>probe:Drosophila_2:1634171_at:481:649; Interrogation_Position=540; Antisense; TCACTTCCGTCAATTTCAGCTCTAA
>probe:Drosophila_2:1634171_at:95:493; Interrogation_Position=97; Antisense; GTAATGCTGAACATCTACGACCTGT

Paste this into a BLAST search page for me
GCAACAACTACACTTTTCCGCTGGGATGTTCCTGAATGCCCTGCGAAGGACGAGAGTACGCATTTTTGGCGCTCATCCATTTCCGGCATCTTTGAGATTCTGAGATTCATCCCTGCAATGGGCAGGAGGAGTTGGGCGAACACTTCCGTTTCCGTTTCCGGAAGAGCATTCTGCTACCGACTTTACCTGCGCTGAAGTGATGAAGCGCGTTATCAACCTGCTGGGGTCTGTGGCCGTAAAATTCCGCGTTCATAACGTGTGTCCCATTCCTCGAAGAACGCTTTGTGGTCTCCAGTCCATTCACTTCCGTCAATTTCAGCTCTAAGTAATGCTGAACATCTACGACCTGT

Full Affymetrix probeset data:

Annotations for 1634171_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720