FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634172_at:

>probe:Drosophila_2:1634172_at:562:11; Interrogation_Position=1019; Antisense; ATTCTTTTCGTAGATCCGATGCTCA
>probe:Drosophila_2:1634172_at:68:445; Interrogation_Position=1036; Antisense; GATGCTCAATACTAACGCTAACGTT
>probe:Drosophila_2:1634172_at:45:383; Interrogation_Position=1211; Antisense; GAACTTTATTCCAATGATTCGTAAT
>probe:Drosophila_2:1634172_at:74:463; Interrogation_Position=1226; Antisense; GATTCGTAATACTTTGCTTGCTTGA
>probe:Drosophila_2:1634172_at:473:721; Interrogation_Position=1312; Antisense; TTGCACACTACGTTTATTTGCCAGT
>probe:Drosophila_2:1634172_at:114:477; Interrogation_Position=1323; Antisense; GTTTATTTGCCAGTTATTTGCGAAA
>probe:Drosophila_2:1634172_at:364:201; Interrogation_Position=1360; Antisense; AACCACGTACTCTGTTTATACATAA
>probe:Drosophila_2:1634172_at:421:409; Interrogation_Position=1434; Antisense; GACGACCAATCTGTAACTTTCAACA
>probe:Drosophila_2:1634172_at:661:453; Interrogation_Position=894; Antisense; GATATAGCCGGTGTGGCCGACGTCA
>probe:Drosophila_2:1634172_at:44:497; Interrogation_Position=915; Antisense; GTCACCATCAGACAGTCCTACAAAC
>probe:Drosophila_2:1634172_at:409:159; Interrogation_Position=934; Antisense; ACAAACTTATGTATCCGCACGCAGC
>probe:Drosophila_2:1634172_at:583:601; Interrogation_Position=943; Antisense; TGTATCCGCACGCAGCTAAGCTTTT
>probe:Drosophila_2:1634172_at:609:401; Interrogation_Position=975; Antisense; GACTTTAAGTTTACCACTCCCATTG
>probe:Drosophila_2:1634172_at:296:145; Interrogation_Position=990; Antisense; ACTCCCATTGATCAGTTACCACAGA

Paste this into a BLAST search page for me
ATTCTTTTCGTAGATCCGATGCTCAGATGCTCAATACTAACGCTAACGTTGAACTTTATTCCAATGATTCGTAATGATTCGTAATACTTTGCTTGCTTGATTGCACACTACGTTTATTTGCCAGTGTTTATTTGCCAGTTATTTGCGAAAAACCACGTACTCTGTTTATACATAAGACGACCAATCTGTAACTTTCAACAGATATAGCCGGTGTGGCCGACGTCAGTCACCATCAGACAGTCCTACAAACACAAACTTATGTATCCGCACGCAGCTGTATCCGCACGCAGCTAAGCTTTTGACTTTAAGTTTACCACTCCCATTGACTCCCATTGATCAGTTACCACAGA

Full Affymetrix probeset data:

Annotations for 1634172_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720