FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634173_at:

>probe:Drosophila_2:1634173_at:611:411; Interrogation_Position=1943; Antisense; GACCACCGACTTTGGCGAGGGCAGT
>probe:Drosophila_2:1634173_at:699:623; Interrogation_Position=1972; Antisense; TGCGCTCAGAGCTCGACACTTTGAT
>probe:Drosophila_2:1634173_at:263:399; Interrogation_Position=1986; Antisense; GACACTTTGATTCCCTGGCTGGAGG
>probe:Drosophila_2:1634173_at:727:99; Interrogation_Position=2034; Antisense; AAAGTAAAAGCCACCACTCGTCTAG
>probe:Drosophila_2:1634173_at:680:307; Interrogation_Position=2063; Antisense; CCATCCCTGTGTAATCACCGTAGAG
>probe:Drosophila_2:1634173_at:431:431; Interrogation_Position=2123; Antisense; GAGTCACCAGGTGCCAGAACAGAAT
>probe:Drosophila_2:1634173_at:677:385; Interrogation_Position=2139; Antisense; GAACAGAATCGATTTGCCCTGCTTC
>probe:Drosophila_2:1634173_at:570:321; Interrogation_Position=2154; Antisense; GCCCTGCTTCAACCAGAACTGGAGA
>probe:Drosophila_2:1634173_at:4:355; Interrogation_Position=2189; Antisense; GCACCCCATCATCAAGAAGCTTAAC
>probe:Drosophila_2:1634173_at:709:511; Interrogation_Position=2221; Antisense; GTGAGAGCGACAAGGATCTGGCCCA
>probe:Drosophila_2:1634173_at:347:705; Interrogation_Position=2248; Antisense; TTATCGCCAAGCAGCTCTTTGCAAA
>probe:Drosophila_2:1634173_at:623:539; Interrogation_Position=2289; Antisense; GGTTTGGCTGAGGATCCCCGCATGC
>probe:Drosophila_2:1634173_at:71:191; Interrogation_Position=2322; Antisense; AACATGAACACTCTGCTATCGCGGG
>probe:Drosophila_2:1634173_at:136:677; Interrogation_Position=2338; Antisense; TATCGCGGGCCCTGGAGAAATACTA

Paste this into a BLAST search page for me
GACCACCGACTTTGGCGAGGGCAGTTGCGCTCAGAGCTCGACACTTTGATGACACTTTGATTCCCTGGCTGGAGGAAAGTAAAAGCCACCACTCGTCTAGCCATCCCTGTGTAATCACCGTAGAGGAGTCACCAGGTGCCAGAACAGAATGAACAGAATCGATTTGCCCTGCTTCGCCCTGCTTCAACCAGAACTGGAGAGCACCCCATCATCAAGAAGCTTAACGTGAGAGCGACAAGGATCTGGCCCATTATCGCCAAGCAGCTCTTTGCAAAGGTTTGGCTGAGGATCCCCGCATGCAACATGAACACTCTGCTATCGCGGGTATCGCGGGCCCTGGAGAAATACTA

Full Affymetrix probeset data:

Annotations for 1634173_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720