Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634174_at:

>probe:Drosophila_2:1634174_at:150:723; Interrogation_Position=1739; Antisense; TTGGTACTGCCCCTGGAAATTGGAA
>probe:Drosophila_2:1634174_at:716:531; Interrogation_Position=1768; Antisense; GGTGGCCATTGGTGTGAATCTTCTC
>probe:Drosophila_2:1634174_at:63:367; Interrogation_Position=1783; Antisense; GAATCTTCTCTTTATCCTGTACTAT
>probe:Drosophila_2:1634174_at:60:269; Interrogation_Position=1813; Antisense; CAGGCCAAAGGTCACGCTGGAGCAA
>probe:Drosophila_2:1634174_at:108:155; Interrogation_Position=1881; Antisense; ACAGATGTCTGATCTTTCCTTCGGT
>probe:Drosophila_2:1634174_at:564:525; Interrogation_Position=1936; Antisense; GGGCAGCAAATCCACATTGCCAGTG
>probe:Drosophila_2:1634174_at:622:353; Interrogation_Position=1971; Antisense; GCACCTATATCTATGCTGCGGATTT
>probe:Drosophila_2:1634174_at:427:125; Interrogation_Position=1999; Antisense; AGCCGCCAAAGTAATATCCTCCATT
>probe:Drosophila_2:1634174_at:319:125; Interrogation_Position=2073; Antisense; AGCCCAGTGTAGTGAGTGTCTTCGA
>probe:Drosophila_2:1634174_at:54:139; Interrogation_Position=2108; Antisense; ACGAGGCTGGTGCTTTGCTACAACA
>probe:Drosophila_2:1634174_at:372:545; Interrogation_Position=2170; Antisense; GGATCTTTCGAGGTCCGTGGACTCA
>probe:Drosophila_2:1634174_at:143:369; Interrogation_Position=2228; Antisense; GAATGCGTGAGCATGGCCAGCACTC
>probe:Drosophila_2:1634174_at:482:309; Interrogation_Position=2244; Antisense; CCAGCACTCTTTCACTAGCTAGAAG
>probe:Drosophila_2:1634174_at:240:373; Interrogation_Position=2265; Antisense; GAAGTTAGTCTTACAACGCCCAAAT

Paste this into a BLAST search page for me
TTGGTACTGCCCCTGGAAATTGGAAGGTGGCCATTGGTGTGAATCTTCTCGAATCTTCTCTTTATCCTGTACTATCAGGCCAAAGGTCACGCTGGAGCAAACAGATGTCTGATCTTTCCTTCGGTGGGCAGCAAATCCACATTGCCAGTGGCACCTATATCTATGCTGCGGATTTAGCCGCCAAAGTAATATCCTCCATTAGCCCAGTGTAGTGAGTGTCTTCGAACGAGGCTGGTGCTTTGCTACAACAGGATCTTTCGAGGTCCGTGGACTCAGAATGCGTGAGCATGGCCAGCACTCCCAGCACTCTTTCACTAGCTAGAAGGAAGTTAGTCTTACAACGCCCAAAT

Full Affymetrix probeset data:

Annotations for 1634174_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime