FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634175_at:

>probe:Drosophila_2:1634175_at:454:63; Interrogation_Position=1006; Antisense; ATGGGCTCGGCCAAGCTAGACTTAA
>probe:Drosophila_2:1634175_at:720:617; Interrogation_Position=1067; Antisense; TGCAGCTGTGCGATTCCAGCGGAAA
>probe:Drosophila_2:1634175_at:57:521; Interrogation_Position=1100; Antisense; GTGGCTTGGGCGAGATACTCATCAA
>probe:Drosophila_2:1634175_at:440:33; Interrogation_Position=1120; Antisense; ATCAATTTGACGCTGTGGCCGCGCA
>probe:Drosophila_2:1634175_at:579:21; Interrogation_Position=1186; Antisense; ATATACTCTATTGTTCGGAAGCGCT
>probe:Drosophila_2:1634175_at:571:381; Interrogation_Position=654; Antisense; GAACGGTTCAGCTGGCTGTAGTCCA
>probe:Drosophila_2:1634175_at:159:87; Interrogation_Position=673; Antisense; AGTCCACCGGAATTGAGCACTCAAC
>probe:Drosophila_2:1634175_at:210:205; Interrogation_Position=736; Antisense; AAGCGCGAAGCCCAATTACGTCAAT
>probe:Drosophila_2:1634175_at:249:139; Interrogation_Position=753; Antisense; ACGTCAATTCGTCTTCTTTCAGCTG
>probe:Drosophila_2:1634175_at:537:329; Interrogation_Position=779; Antisense; GCGTGCATCTCAAATCCGGCAGTGA
>probe:Drosophila_2:1634175_at:41:67; Interrogation_Position=824; Antisense; ATGGACTGAGTGATCCTTATGTCAA
>probe:Drosophila_2:1634175_at:534:493; Interrogation_Position=844; Antisense; GTCAAGTTCAAGGTCGGTGGCCGTC
>probe:Drosophila_2:1634175_at:516:45; Interrogation_Position=905; Antisense; ATCCCGTATGGGACGAGGTCTTCAT
>probe:Drosophila_2:1634175_at:194:405; Interrogation_Position=989; Antisense; GACTGCAGGACGATTTTATGGGCTC

Paste this into a BLAST search page for me
ATGGGCTCGGCCAAGCTAGACTTAATGCAGCTGTGCGATTCCAGCGGAAAGTGGCTTGGGCGAGATACTCATCAAATCAATTTGACGCTGTGGCCGCGCAATATACTCTATTGTTCGGAAGCGCTGAACGGTTCAGCTGGCTGTAGTCCAAGTCCACCGGAATTGAGCACTCAACAAGCGCGAAGCCCAATTACGTCAATACGTCAATTCGTCTTCTTTCAGCTGGCGTGCATCTCAAATCCGGCAGTGAATGGACTGAGTGATCCTTATGTCAAGTCAAGTTCAAGGTCGGTGGCCGTCATCCCGTATGGGACGAGGTCTTCATGACTGCAGGACGATTTTATGGGCTC

Full Affymetrix probeset data:

Annotations for 1634175_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720