Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634176_a_at:

>probe:Drosophila_2:1634176_a_at:296:405; Interrogation_Position=110; Antisense; GACGGCCTGGTTCAGACTTCGAACT
>probe:Drosophila_2:1634176_a_at:253:717; Interrogation_Position=140; Antisense; TTCGAGCCGACCATATCGCAGGAGA
>probe:Drosophila_2:1634176_a_at:312:87; Interrogation_Position=192; Antisense; AGTGCCATCTGACGGTTGACCAGTT
>probe:Drosophila_2:1634176_a_at:161:467; Interrogation_Position=214; Antisense; GTTGGACATTGAGATTCTGCCGATA
>probe:Drosophila_2:1634176_a_at:214:279; Interrogation_Position=241; Antisense; CTACGACATTGTGCGCTGCGTGGAA
>probe:Drosophila_2:1634176_a_at:102:225; Interrogation_Position=266; Antisense; AAGGATCCTCTGGAGAACGCCGTTA
>probe:Drosophila_2:1634176_a_at:26:109; Interrogation_Position=279; Antisense; AGAACGCCGTTAAGCTGCGCGAGTC
>probe:Drosophila_2:1634176_a_at:648:429; Interrogation_Position=299; Antisense; GAGTCCCAGGATTGCAACCACAAGA
>probe:Drosophila_2:1634176_a_at:469:99; Interrogation_Position=321; Antisense; AGATGGTGCTGCGACTGCTAATGCG
>probe:Drosophila_2:1634176_a_at:172:657; Interrogation_Position=339; Antisense; TAATGCGCTACCTGGCCAACAACGA
>probe:Drosophila_2:1634176_a_at:512:425; Interrogation_Position=386; Antisense; GAGAGCTATCCCATGAGACGCGCTG
>probe:Drosophila_2:1634176_a_at:571:479; Interrogation_Position=422; Antisense; GTTTCCCTGATGTACCGCACAAAAG
>probe:Drosophila_2:1634176_a_at:550:357; Interrogation_Position=438; Antisense; GCACAAAAGACTTGGCCCGGGAGCA
>probe:Drosophila_2:1634176_a_at:279:305; Interrogation_Position=482; Antisense; CCAGAGCGTTTCAAATCCTTCGTTA

Paste this into a BLAST search page for me
GACGGCCTGGTTCAGACTTCGAACTTTCGAGCCGACCATATCGCAGGAGAAGTGCCATCTGACGGTTGACCAGTTGTTGGACATTGAGATTCTGCCGATACTACGACATTGTGCGCTGCGTGGAAAAGGATCCTCTGGAGAACGCCGTTAAGAACGCCGTTAAGCTGCGCGAGTCGAGTCCCAGGATTGCAACCACAAGAAGATGGTGCTGCGACTGCTAATGCGTAATGCGCTACCTGGCCAACAACGAGAGAGCTATCCCATGAGACGCGCTGGTTTCCCTGATGTACCGCACAAAAGGCACAAAAGACTTGGCCCGGGAGCACCAGAGCGTTTCAAATCCTTCGTTA

Full Affymetrix probeset data:

Annotations for 1634176_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime