FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634179_at:

>probe:Drosophila_2:1634179_at:212:31; Interrogation_Position=1904; Antisense; ATCAATACCCGCGATACGGCTGTAG
>probe:Drosophila_2:1634179_at:661:447; Interrogation_Position=1940; Antisense; GATGCCCAGTTTGTGGCACCGATTG
>probe:Drosophila_2:1634179_at:62:289; Interrogation_Position=2087; Antisense; CGGTGCTACTTTTACGTGTTCGATT
>probe:Drosophila_2:1634179_at:720:223; Interrogation_Position=2120; Antisense; AAGGACGGCGACTATCCACAGAGAA
>probe:Drosophila_2:1634179_at:294:405; Interrogation_Position=2198; Antisense; GACGGCTTTAGTCACTTTCCGCAAA
>probe:Drosophila_2:1634179_at:95:667; Interrogation_Position=2225; Antisense; TACACCAAATCGGAGACGGCTCTTT
>probe:Drosophila_2:1634179_at:129:573; Interrogation_Position=2242; Antisense; GGCTCTTTCCGAGGCGGTGATGATA
>probe:Drosophila_2:1634179_at:625:19; Interrogation_Position=2264; Antisense; ATATTCTGGACCAACTTTGCTCGCA
>probe:Drosophila_2:1634179_at:696:229; Interrogation_Position=2300; Antisense; AATGAACACCATCGCCAGGACTCGT
>probe:Drosophila_2:1634179_at:133:639; Interrogation_Position=2321; Antisense; TCGTCGCTGCCGGTTTCAAAGGAGC
>probe:Drosophila_2:1634179_at:453:341; Interrogation_Position=2352; Antisense; GCTTTCGCAGCATCACCTGGGAAAA
>probe:Drosophila_2:1634179_at:606:387; Interrogation_Position=2372; Antisense; GAAAATTATGATCCGCTGCACCAGA
>probe:Drosophila_2:1634179_at:255:107; Interrogation_Position=2422; Antisense; AGAAAGTTTCCTGCTTTTCTCCATA
>probe:Drosophila_2:1634179_at:52:421; Interrogation_Position=2461; Antisense; GAGCACTTTCCATGTTTTTGTGTGA

Paste this into a BLAST search page for me
ATCAATACCCGCGATACGGCTGTAGGATGCCCAGTTTGTGGCACCGATTGCGGTGCTACTTTTACGTGTTCGATTAAGGACGGCGACTATCCACAGAGAAGACGGCTTTAGTCACTTTCCGCAAATACACCAAATCGGAGACGGCTCTTTGGCTCTTTCCGAGGCGGTGATGATAATATTCTGGACCAACTTTGCTCGCAAATGAACACCATCGCCAGGACTCGTTCGTCGCTGCCGGTTTCAAAGGAGCGCTTTCGCAGCATCACCTGGGAAAAGAAAATTATGATCCGCTGCACCAGAAGAAAGTTTCCTGCTTTTCTCCATAGAGCACTTTCCATGTTTTTGTGTGA

Full Affymetrix probeset data:

Annotations for 1634179_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720