Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634182_at:

>probe:Drosophila_2:1634182_at:303:265; Interrogation_Position=2168; Antisense; CAGACTCATATGTGTTAGGATCCTA
>probe:Drosophila_2:1634182_at:50:547; Interrogation_Position=2185; Antisense; GGATCCTATATATACACCCACATAC
>probe:Drosophila_2:1634182_at:347:599; Interrogation_Position=2222; Antisense; TGTAGTTATCGTGTAGCTTCCGCTT
>probe:Drosophila_2:1634182_at:102:487; Interrogation_Position=2234; Antisense; GTAGCTTCCGCTTCATATATTTTAT
>probe:Drosophila_2:1634182_at:141:393; Interrogation_Position=2282; Antisense; GAAACCACCAAACTTCCGAACATGT
>probe:Drosophila_2:1634182_at:705:601; Interrogation_Position=2304; Antisense; TGTTACCTTTCCTTTGTAGTGGCAA
>probe:Drosophila_2:1634182_at:332:399; Interrogation_Position=2462; Antisense; GACACTTTCGCTGACACATGATGGA
>probe:Drosophila_2:1634182_at:441:87; Interrogation_Position=2496; Antisense; AGTCGACAGTAGGTGCCCCATTTAT
>probe:Drosophila_2:1634182_at:484:647; Interrogation_Position=2522; Antisense; TCATCCACCATCAGAGTTAGCCGAT
>probe:Drosophila_2:1634182_at:553:473; Interrogation_Position=2537; Antisense; GTTAGCCGATTAGCCTGTAAGTGAA
>probe:Drosophila_2:1634182_at:45:241; Interrogation_Position=2561; Antisense; AATAGCGACCATTCTTTGTGGAATC
>probe:Drosophila_2:1634182_at:97:519; Interrogation_Position=2578; Antisense; GTGGAATCTACACACGGACACACGT
>probe:Drosophila_2:1634182_at:141:399; Interrogation_Position=2594; Antisense; GACACACGTAGAATCTCTCTAGCGG
>probe:Drosophila_2:1634182_at:316:417; Interrogation_Position=2662; Antisense; GAGCGACATTTTGTTGGTTTCCTTT

Paste this into a BLAST search page for me
CAGACTCATATGTGTTAGGATCCTAGGATCCTATATATACACCCACATACTGTAGTTATCGTGTAGCTTCCGCTTGTAGCTTCCGCTTCATATATTTTATGAAACCACCAAACTTCCGAACATGTTGTTACCTTTCCTTTGTAGTGGCAAGACACTTTCGCTGACACATGATGGAAGTCGACAGTAGGTGCCCCATTTATTCATCCACCATCAGAGTTAGCCGATGTTAGCCGATTAGCCTGTAAGTGAAAATAGCGACCATTCTTTGTGGAATCGTGGAATCTACACACGGACACACGTGACACACGTAGAATCTCTCTAGCGGGAGCGACATTTTGTTGGTTTCCTTT

Full Affymetrix probeset data:

Annotations for 1634182_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime